KEGG   Rhodobacter sphaeroides 2.4.1: RSP_7596Help
Entry
RSP_7596          CDS       T00284                                 

Definition
(RefSeq) hypothetical protein
Organism
rsp  Rhodobacter sphaeroides 2.4.1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 17312418
NCBI-ProteinID: YP_008686457
UniProt: U5NMX9
Position
2:301159..301860
Genome map
AA seq 233 aa AA seqDB search
MKRLTLTTCALALAGATAAHADCAADLASLTGASADMPSSSGAAADSGSTTGASGTDMSA
AGGSDMSTTGSAAGGSDMAAGSGAGGTSSSAMTGSSDVAGGSTSTGSGSGSGTDMAGSGA
TGSGTTGTSATGPGTAGSDGASGMAEGEGISKDGSLAPLEGADGSGSNSATTAMSGADAE
AQQNGEPTAAQSAEAGSGEGANTRAGVIQEARTALARGDEAACLAAIEKARGL
NT seq 702 nt NT seq  +upstreamnt  +downstreamnt
atgaaacgcctgaccctcacgacctgcgccctggcgctcgccggagccaccgccgcccat
gccgactgtgccgcggaccttgcatccctgaccggcgcgtccgcggacatgccgtcctcg
agcggggccgctgcggacagcggatccaccaccggcgcttcgggaacggacatgtccgcc
gcgggcggctccgacatgagcacgaccggttcggctgccggaggctccgacatggcggcg
gggtcgggtgccggcggcacctccagctccgcgatgaccggcagctccgacgtggccggc
gggtctacctccacgggttccggctcgggcagcgggaccgacatggcgggctccggagca
acgggctcgggcacgaccggcacgagcgcgaccggccccgggaccgccggatcggacggc
gcttcgggcatggccgagggcgagggcatctcgaaggacggctcgctcgcgccgctggag
ggcgcagacggcagcgggagcaacagcgcgaccacggccatgtccggcgccgatgccgaa
gcccagcagaacggcgagccgacggcggcccagtcggccgaggccggatcgggggagggc
gcgaacacccgcgccggcgtcattcaggaagcccgcaccgctcttgcccggggcgacgag
gcggcctgcctcgcggccatcgagaaggcccgcggcctctga

DBGET integrated database retrieval system