KEGG   Streptococcus agalactiae A909 (serotype Ia): SAK_1765Help
Entry
SAK_1765          gene      T00278                                 

Definition
(GenBank) pseudogene
Organism
sak  Streptococcus agalactiae A909 (serotype Ia)
SSDB OrthologParalogGene clusterGFIT
Position
1760509..1761370
Genome map
NT seq 862 nt NT seq  +upstreamnt  +downstreamnt
atgccattaaatcaattttttatattaaataatggagtaaaaataccaagtcttggcttt
ggcgttttccaaatagatgaccctctagagtgcgaacaatccgtcttagatgcacttcaa
gttggttatcgcctcattgacacagcttctggataccttaatgaggaggcagttggtcgt
gctattaagaaatcaggaatccccagaaaagaaatttttgtcgtgactaaactttggatc
caagatgcatctgaggaaaaggctggacctgctattgatagagcattaaaaaggttacaa
ctagactatattaacctttatttaatccatcaaccaatgggggattattatggggcatgt
cgtgcattagaaaaagcctacgaggagagaaaagctctagcaattggtgtttctaatttt
tcaaatggacgagttcaagatttaatcttacataacaagattatccctgcggtcaatcag
atacaaatgaacccttttcatcctgcaaaagatcaagtagagtggttaagcaaaaagggc
atccatactatggcttggggaccatttgcagaagcgaaatacggaatctttcagtatcct
actttggtagagattgcggaacgctataataaaaactgtgtctcaaataatcctagcttg
ggaagtgaaaaacaaagtaacagtcatttcaaaaactgtgcacaaagctcgtattatggg
aaatatggacttttttgacatattattaaccgatgatgatatgactaaaatagcaagcct
tgaaaaatcagaatatctatttggtgatgtagaatcactggagctaattgaatacttatc
aaataatgtttttgatatatag

DBGET integrated database retrieval system