KEGG   Staphylococcus aureus subsp. aureus NCTC8325: SAOUHSC_01993
Entry
SAOUHSC_01993     gene      T00324                                 

Name
(RefSeq) pseudogene
Organism
sao  Staphylococcus aureus subsp. aureus NCTC8325
SSDB
Other DBs
NCBI-GeneID: 3921876
Position
1897329..1898648
NT seq 1320 nt   +upstreamnt  +downstreamnt
atgtgtaatgataccttagaattactaagaataaaagatgaaaatataaaatatataaac
caagaaattgacgtcattatcaaaggaaaaaaagcaacagtggttaatgctgtactaacg
tataagccttcggcctgttattgttgtggagttaaaaatgaaggacaaattcataaacat
ggtaagcgtgtttctcgtattactttacttaaaactcaagggtataacacatacctcaac
ttagctaaacaacgttttaaatgcttagaatgcaatggcacttttactgctaaaacgtca
attgttgatgagtcgtgttttatctcaagatgtgttactcaaaaagttatagaagaagct
actaaagttaaaacagagattgatactgcagaagataactgtatctctccatctactgta
agtcgtattagaactaaagcggctaattcattacgaattaaaccctttaattgtttgcca
gaacacatcgctatggatgaatttaaaagcgttaaaaatgtaactggatcaatgagtttc
atttttatagataatgatactcatgatgttatagatattttagaaaatagaactacaaga
ttcttgcgtgcctatttcgagcgattcgatttaaaaaatcgacaacaagttaagacggtt
actattgacatgtatgaaccctatgtccgattatttcgcgacctatttcctaatgcagct
attatttttgacagattccatatcgttcaacatttaaatagagaacttaataagtatcgt
gtacaagttatgaatgaataccgtaataaaaaaggacctgattatacaatttttaagaat
aactggaaagtcctattgatggatactagtaaaaccatatttagtaaatacagatggaat
aaatcttttaaggcttataaacgctcatctgacattgtagaattcatgctttcaaaagac
gatatactacgacactcctacgaacttgtccaaggattacgaaaagacctaaggttatgt
aattggcctaaatttattaatcgtttaaattcagttagtaaaaagtctgtgagtaagggt
gtatggaaagtggttaaatattatagaaaacatcaaaggatgttaagaaatacaatttat
tacccagcatttaataatggtgctatagaaggaattaataataagataaaattaatcaag
tgaatttcttttggttacagaaatttcaacaactttaaagcacgtataatgatgattttc
agcttgtacaaaggagaaaaaaagaagacaaccaagcccaataatggactggccgcctaa

DBGET integrated database retrieval system