KEGG   Shewanella amazonensis: Sama_R0077Help
Entry
Sama_R0077        tRNA      T00445                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
saz  Shewanella amazonensis
Pathway
saz00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:saz00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Sama_R0077
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:saz03100]
    Sama_R0077
Non-coding RNAs [BR:saz03100]
 Transfer RNA
  tRNA
   Sama_R0077
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
2227460..2227535
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
tcccctgtagttcagtcggtagaacggcggactgttaatccgtatgtcactggttcaagt
ccagtcaggggagcca

DBGET integrated database retrieval system