KEGG   Sphaerochaeta coccoides: Spico_0134Help
Entry
Spico_0134        gene      T01469                                 

Definition
(GenBank) pseudogene
Organism
scc  Sphaerochaeta coccoides
SSDB OrthologParalogGene clusterGFIT
Position
157585..157738
Genome map
NT seq 154 nt NT seq  +upstreamnt  +downstreamnt
tgggaacagcggaagatgggcgatgttgctgatattgtccgtggagcaagccctcgtccc
atcaatgatcccaagtggtttagcgataaatctgacgttggctggttgcgaatttcagaa
cgtgactgagcaaaatggaagaatccattacctt

DBGET integrated database retrieval system