KEGG   Saccharomyces cerevisiae (budding yeast): NME1
Entry
NME1              ncRNA     T00005                                 

Definition
(RefSeq) NME1
  KO
K14576  small nucleolar RNA MRP
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce03008  Ribosome biogenesis in eukaryotes
Brite
KEGG Orthology (KO) [BR:sce00001]
 09120 Genetic Information Processing
  09122 Translation
   03008 Ribosome biogenesis in eukaryotes
    NME1
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03009 Ribosome biogenesis [BR:sce03009]
    NME1
  09184 RNA family
   03100 Non-coding RNAs [BR:sce03100]
    NME1
Ribosome biogenesis [BR:sce03009]
 Related small nucleolar RNAs
  Other snoRNA
   NME1
Non-coding RNAs [BR:sce03100]
 Small non-coding RNA
  Small nucleolar RNA
   NME1
SSDB
Other DBs
NCBI-GeneID: 9164967
SGD: S000007436
Position
XIV:585587..585926
NT seq 340 nt   +upstreamnt  +downstreamnt
aatccatgaccaaagaatcgtcacaaatcgaagcttacaaaatggagtaaaatttttttt
actcagtaatatgctttgggttgaaagtctcccaccaattcgtatgcggaaaacgtaatg
agatttaaaaattttaaattgtttaaatcaactcattaaggaggatgcccttgggtattc
tgcttcttgacctggtacctctattgcagggtactggtgttttcttcggtactggattcc
gtttgtatggaatctaaaccatagttatgacgattgctctttcccgtgctggatcgagta
acccaatggagcttactattcttggtccatggattcaccc

DBGET integrated database retrieval system