KEGG   Saccharomyces cerevisiae (budding yeast): YBR058C-AHelp
Entry
YBR058C-A         CDS       T00005                                 

Gene name
TSC3
Definition
(RefSeq) Tsc3p
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 852350
NCBI-ProteinID: NP_116327
SGD: S000007521
UniProt: Q3E790
Position
II:complement(356324..356566)
Genome map
AA seq 80 aa AA seqDB search
MTQHKSSMVYIPTTKEAKRRNGKSEGILNTIEEVVEKLYWTYYIHLPFYLMASFDSFFLH
VFFLTIFSLSFFGILKYCFL
NT seq 243 nt NT seq  +upstreamnt  +downstreamnt
atgacacaacataaaagctcgatggtgtacatacccaccactaaggaagctaaaagacgt
aatgggaaatcagaaggcatactaaatactattgaagaagtggtggaaaagctttattgg
acctactacatacatttacccttttatttaatggcctcttttgattcattcttcctccat
gttttttttctcacaattttcagtttgagtttcttcggtatactaaagtattgcttcctt
tga

DBGET integrated database retrieval system