KEGG   Saccharomyces cerevisiae (budding yeast): YDL223CHelp
Entry
YDL223C           CDS       T00005                                 

Gene name
HBT1
Definition
(RefSeq) Hbt1p
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 851303
NCBI-ProteinID: NP_010058
SGD: S000002382
UniProt: Q07653
Position
IV:complement(57265..60405)
Genome map
AA seq 1046 aa AA seqDB search
MNMNESISKDGQGEEEQNNFSFGGKPGSYDSNSDSAQRKKSFSTTKPTEYNLPKEQPEST
SKNLETKAKNILLPWRKKHNKDSETPHEDTEADANRRANVTSDVNPVSADTKSSSGPNAT
ITTHGYSYVKTTTPAATSEQSKVKTSPPTSHEHSNIKASPTAHRHSKGDAGHPSIATTHN
HSTSKAATSPVTHTHGHSSATTSPVTHTHGHASVKTTSPTNTHEHSKANTGPSATATTHG
HINVKTTHPVSHGHSGSSTGPKSTAAAQDHSSTKTNPSVTHGHTSVKDNSSATKGYSNTD
SNSDRDVIPGSFRGMTGTDVNPVDPSVYTSTGPKSNVSSGMNAVDPSVYTDTSSKSADRR
KYSGNTATGPPQDTIKEIAQNVKMDESEQTGLKNDQVSGSDAIQQQTMEPEPKAAVGTSG
FVSQQPSYHDSNKNIQHPEKNKVDNKNISERAAEKFNIERDDILESADDYQQKNIKSKTD
SNWGPIEYSSSAGKNKNLQDVVIPSSMKEKFDSGTSGSQNMPKAGTELGHMKYNDNGRDN
LQYVAGSQAGSQNTNNNIDMSPRHEAEWSGLSNDATTRNNVVSPAMKDEDMNEDSTKPHQ
YGLDYLDDVEDYHENDIDDYSNAKKNDLYSKKAYQGKPSDYNYEQREKIPGTFEPDTLSK
SVQKQDEDPLSPRQTTNRAGMETARDESLGNYEYSNTSGNKKLSDLSKNKSGPTPTRSNF
IDQIEPRRAKTTQDIASDAKDFTNNPETGTTGNVDTTGRMGAKSKTFSSNPFDDSKNTDT
HLENANVAAFDNSRSGDTTYSKSGDAETAAYDNIKNADPTYAKSQDITGMTHDQEPSSEQ
KASYGSGGNSQNQEYSSDDNIDVNKNAKVLEEDAPGYKREVDLKNKRRTDLGGADASNAY
AAEVGNFPSLIDPHVPTYGFKDTNTSSSQKPSEGTYPETTSYSIHNETTSQGRKVSVGSM
GSGKSKHHHNHHRHSRQNSSKGSDYDYNNSTHSAEHTPRHHQYGSDEGEQDYHDDEQGEE
QAGKQSFMGRVRKSISGGTFGFRSEI
NT seq 3141 nt NT seq  +upstreamnt  +downstreamnt
atgaatatgaacgagtccatttccaaagatggtcaaggcgaagaagaacaaaataatttt
tcgtttggtggtaagcccggttcctatgattccaattcagattctgctcaacgcaaaaag
tctttcagtactacaaagccgaccgaatataacttaccaaaagaacagcccgaatcaacg
tccaagaatttggaaaccaaggctaaaaacattctgttaccttggaggaagaagcataat
aaagactcggaaactccacacgaagacactgaggcggacgctaaccgccgtgccaacgta
acttctgatgtgaaccctgtttctgccgacaccaagtcaagttctggccctaatgctact
attactacccatggatactcttatgtcaaaacaacgacacccgctgctacaagtgagcaa
tccaaagtgaaaacgtcacctcccactagccatgaacattcaaatataaaggcgtccccc
actgcgcatagacattccaaaggtgatgcagggcatccaagtattgcaaccactcataac
cacagcacttccaaagctgccacttctcctgttactcacacgcatggtcattccagtgct
accacttcccctgtcactcacacacatggtcatgccagtgtgaaaaccacatctcctacc
aatactcatgagcattctaaagcgaatactggtccatcagccactgcaactacacatgga
catatcaacgtcaaaactacccaccctgttagccatggtcactctggttcaagcactggt
cctaaatccaccgctgctgcacaggatcattccagtactaaaactaacccttcagttact
catggacatacaagtgttaaagataactcctcagctacgaagggttattcgaacactgat
tccaactcagatcgagatgtcatacctggtagtttccggggcatgactggtactgatgtg
aaccctgttgatcctagtgtttacacaagtacaggcccaaagagtaatgttagttccggt
atgaacgctgtcgaccctagtgtctacacggacacaagttcgaagtctgcagatcgtaga
aagtactctggcaacactgcgactggtcctcctcaagatacaattaaagaaattgcacag
aacgtgaagatggatgagagcgaacaaactggattgaaaaatgaccaagtttctggttct
gatgcaatccaacagcaaactatggaacctgaacccaaagcagcagtcgggacaagtggt
tttgtaagccagcaaccttcttatcatgatagcaataaaaacattcaacacccagaaaag
aataaggttgataataaaaatatatcagaaagagcggctgaaaaatttaacattgaaaga
gatgacattctggaatccgccgatgattatcaacagaaaaacattaaatccaagacggat
tctaattggggtccaattgaatatagttccagcgctggtaaaaataagaatctgcaggat
gttgttataccttctagtatgaaggagaaattcgacagcggtacatctggatctcagaat
atgcctaaagcgggaaccgaattaggacatatgaagtataatgataatggtagggataac
ttgcaatatgttgccggttcacaagctggttctcaaaatacgaacaacaatattgacatg
tcaccccgtcatgaagcagaatggtccgggctttctaatgatgccaccacccgaaacaat
gttgtatcacctgctatgaaggacgaagatatgaatgaagattctactaaacctcatcaa
tatgggttggattatttggatgatgttgaagactaccacgagaatgatattgacgactac
tcaaatgcaaagaaaaacgacttgtattctaagaaagcgtaccagggaaaaccatcggat
tacaattatgagcagagagagaaaatcccaggtacttttgaacctgatacgttgtcaaaa
tcagtgcaaaaacaagatgaagacccgttgtctccaaggcaaaccactaaccgtgctggt
atggagactgcaagagatgagagtcttggcaattacgaatactcgaatacttctggtaac
aaaaaattatctgatttaagcaaaaataaatcaggcccaactccaacgcgttctaatttt
attgaccaaattgagccaagaagagcaaaaacaacacaggatattgcatccgatgccaag
gatttcaccaataatccggaaacaggtactactggaaacgtagatacaaccggaaggatg
ggtgcaaaatccaagaccttcagctcgaacccttttgatgatagtaaaaatacagacact
catctcgaaaacgctaatgttgctgcctttgataattccagatctggagacactacatac
tccaaatcaggggatgctgaaacagctgcttacgataatattaaaaatgcggaccctaca
tatgccaaatcacaagatattactggaatgactcacgatcaggaaccatcatcagaacaa
aaggccagttacggttctggcggcaattcccaaaatcaagaatattctagcgacgataat
attgatgtcaataagaatgcgaaagttttagaggaagacgcaccgggctacaagcgtgaa
gtagatttgaagaacaaacgtagaaccgaccttggtggtgccgacgcctcaaacgcttat
gctgccgaagttggtaatttccctagtttgattgacccacatgtcccaacatacggattt
aaagacaccaacacctctagttctcaaaagccatctgagggcacctacccagaaaccact
tcctattcaattcataatgaaacaacttctcagggaaggaaagtgtcggtgggttcaatg
ggttccggaaaatcaaaacatcatcacaatcatcaccgtcacagcagacagaattcttca
aaagggtctgactacgactataataattctactcattcagccgagcacactccaagacat
catcagtacggttccgatgagggtgagcaagattaccatgacgacgagcaaggtgaggaa
caggctggtaaacaaagtttcatgggtagagtgagaaaaagtatttctggcggtactttt
ggatttaggagtgaaatttaa

DBGET integrated database retrieval system