KEGG   Saccharomyces cerevisiae (budding yeast): YDL237WHelp
Entry
YDL237W           CDS       T00005                                 

Gene name
AIM6
Definition
(RefSeq) Aim6p
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 851361
NCBI-ProteinID: NP_010044
SGD: S000002396
UniProt: Q07716
Position
IV:30657..31829
Genome map
AA seq 390 aa AA seqDB search
MLGLKGCLTILIGYVIAVCALFSSRGRNPSLTDWEKLKDQKISNIDNFGLTGQHLLEFFQ
ENLPFLSFSEEKYRHKHVSLYYDVFKEYILRRASSKKCLPVDSAIAKLNKDVNPMPVHSH
NDYWRKLPLFEGLAYGASSTEADVWNIDEKILAVGHNEAYLDPVELTLDKLYTGPLLEIL
DEVNCQDSDADRKNGVFFNSPETSLFFYIDFKSDDNELTYKLLMEQYFKSLIDSGYLTYY
DMKKDEIIWRPVTVILTGNYPTSLDILDNGNDNGYFESSQRFAFLDAPLLSLEPKYSKLS
VAATVSFSQLMKHCGSDHWKVSLRGRMDSNEISCAKSIIDGAHALKLKTRIWGAPTWPAN
LVETISRQIIHDLGSDLLNLDNLFMASSLI
NT seq 1173 nt NT seq  +upstreamnt  +downstreamnt
atgttaggactgaaagggtgtctaactattcttattggatacgttattgctgtctgtgct
ttgttttccagtaggggaagaaatccttcattaactgattgggaaaagttaaaggaccag
aaaatatcgaatattgataactttgggttgaccggtcaacatcttttagaatttttccag
gaaaacttgccatttctaagtttttcagaggaaaagtatcgtcacaaacacgtttcttta
tattatgatgtattcaaagaatatatcttacgtcgtgccagttcaaaaaagtgtttacca
gtagactctgctatcgcaaagttgaacaaagatgttaacccaatgccagttcactcccat
aatgactactggaggaaacttccgctttttgaaggtctggcctatggtgctagtagtact
gaagccgacgtgtggaatatagatgaaaagatcctagctgtgggtcataatgaagcgtat
ttggacccagttgaattgacattagacaagctatacactggccccctcttggagatttta
gacgaggtgaattgccaagattcagacgccgatcgcaaaaatggtgtatttttcaactct
ccagaaacttcactcttcttttatattgatttcaagtcggatgataacgaactaacttat
aaactgctgatggagcaatatttcaaatctctgattgattctggatatttgacatattac
gatatgaagaaggatgaaattatttggagacctgttactgtgatactaacgggcaactac
ccgacgtcattggatattttagacaatggaaatgataacggctattttgagtcaagtcaa
aggtttgcatttctagatgcgccgttgttaagtttggagcccaaatactcaaagctatct
gtagctgcgacggtttcgttcagccaattaatgaaacattgtggttctgatcattggaaa
gtatcgctaagaggtcgtatggattcgaatgagatcagttgtgctaaaagcataattgat
ggtgctcacgcattgaaacttaaaacaagaatttggggagccccaacctggccagctaac
ctggtggaaactatttctcgccaaattattcatgacttgggttccgatttacttaacctg
gacaatttattcatggcatcgtcattgatataa

DBGET integrated database retrieval system