KEGG   Saccharomyces cerevisiae (budding yeast): YER033CHelp
Entry
YER033C           CDS       T00005                                 

Gene name
ZRG8
Definition
(RefSeq) Zrg8p
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 856755
NCBI-ProteinID: NP_010950
SGD: S000000835
UniProt: P40021
Position
V:complement(218057..221287)
Genome map
AA seq 1076 aa AA seqDB search
MRSFIKAHKKSTSFDESPKRHSNFSGNTNNSSQRSSDDSLDFLPSTPSQMNYDSIPPPAK
HSPGFESFHRLANKTSKLFKKTSNSNLNSHLASTPTTSTNQTTSNSFVLQNPPTKNTGPP
PPLPPPLFPSSSTSSFSRHDNESEYTAYKKTSPAKDFNRTTDSLPAIKGTITHSWGDSKV
ESHVIILNDPASPASNTSEATSSKQFKTPIIGNENLTSTTSPSNLEPAIRILNKNKGKQQ
ENIDDAEDGSSKKEHHVYKALALAKNRNRQARIHSHDDIINLGKASQMDMSLLAAAFSGN
STTTINNDQSSNEQTDEKILDIERVTTTSTLTSSETTSPINKSPCFYSQTLSLSPKIRHG
DLQSSPSKVNKNDSQNETLNKKKVRISLNRKEEEKVYSLNNNSDEYSVNEKETHKANDCN
DESSENGDGDNDHDDDYDDDDDDDDDDDESEFSFEYAGINVRTSSVKYYSKPEPAANVYI
DDLYEDENFDDDMNCIEDDESGNEGNEICGLSTRFEETSLKSNKVKKFNDLFNLSDDDEE
EDGKDNSNNGDENESDNLYQKRLENGKETFNGNHGGHHDDASLGETVDNKEQFLINDNVK
KPIQKYNDLFDLSDEDDNDDKEMSEAESYMFSDEAPSIESGPANAKSTRGIYSQSNKNII
RDGKPNYSFSLKRNNSDDETEHTSAIKASLTGTTGSTKPTVKSFSDIFNVDDSASDAESD
SGTGGNNSNGLVSNDSERQVSLQSSLYETKSESHPPNHPHSQILQTPAKIVITPSVSDAQ
SQALAITDDDGEDDDDDTSSILRTPFQLIDSSHSQQPHYASPQYTAVLNSPPLPPPARSQ
SLKYHDLNCDLDSEVPRPMSNLFFIDEAEEDEYNQKSKFFDFDHYDIDEINGIPEDFNFS
DSERDDLNRRTLKSPLRGGSKNREVSPFSSVSSSFRSTHSFNGKLTINQGAKELAPMKNK
IELTNKTVTFFNSNNWNTYDCNSLSRKTSSQMRDSKYQNHNVGQNVEPSSVLSPQHQISN
GLDGKCNDNYVISPNLPTTITPTNSFTKPTPEFSNDYSLSPIQETPSSVQSSPKRA
NT seq 3231 nt NT seq  +upstreamnt  +downstreamnt
atgcggtctttcataaaagcccataagaagtccacgtcgtttgatgaaagccccaagcga
catagcaacttcagtggcaatactaataatagttctcaaaggtcaagtgatgactcctta
gactttctaccatctacaccatcacaaatgaattacgatagcattccaccacccgcgaaa
cactcacctggatttgagtctttccatcgtttggctaacaagacttcaaagttgttcaag
aaaacttcaaactcaaacttaaactcgcatttagcttcaactccaaccacaagcacaaat
cagactacttcaaattcatttgttctccaaaatccacccacaaaaaatactggacctccg
ccgccattaccaccgccgctctttccttcctcttctacctcttccttttcacgtcatgac
aatgaaagtgaatatactgcatataaaaaaacttctcctgcaaaagattttaatagaacc
acagactctctgcctgctattaagggcacaattactcattcgtggggagattccaaggtc
gaatcgcacgtaataatattaaacgatcctgcttccccagcatcaaacacatctgaagcg
acttcttctaaacaattcaaaacccctatcattggcaatgaaaatctaacttcaactaca
tcaccatctaacctggaacctgccataagaatattgaacaagaacaagggtaaacagcag
gaaaatatcgacgatgctgaggacgggtcatctaagaaggaacatcatgtttataaagca
ttagcgcttgccaaaaatagaaacagacaagcaagaattcattctcatgatgatataata
aatttgggaaaggcttctcaaatggatatgagtctactagccgctgcgttttccggaaat
tcaaccaccaccattaataatgaccaatcttctaatgaacaaaccgatgagaaaatatta
gacatcgaaagagtgaccactacttccactttaacctcttccgaaaccacatcaccaata
aacaagtcaccttgtttttatagtcaaacactttccctctcaccaaagatacgacacggc
gacttacaatcatcaccttcaaaagtgaacaaaaacgatagtcaaaacgagaccttgaac
aagaaaaaagtaaggattagtcttaatagaaaagaagaagaaaaggtgtattccctcaac
aacaattccgatgaatactctgtcaatgaaaaagaaacccataaagccaacgattgtaat
gacgaatcttctgaaaacggtgatggcgataatgatcatgatgatgattatgatgacgat
gatgatgacgatgatgatgatgatgagtcggaattttcgtttgaatatgccggcataaac
gtaaggacatcatctgtaaagtattactccaaaccggaaccggcggcaaatgtatacata
gacgatctatatgaggatgagaactttgatgacgatatgaattgtatagaagatgatgag
agtggtaatgagggaaacgaaatatgcggtttatcgactcgattcgaagaaacatccttg
aaaagcaataaagtcaaaaagttcaatgatctttttaacttgagcgatgatgatgaggag
gaggatggtaaagataacagtaacaatggagatgaaaatgagagtgataatctttatcaa
aaacgattagaaaacgggaaagaaacttttaatggtaaccatggcggacaccatgatgat
gcatctcttggagaaacggttgacaacaaagagcagtttctaataaacgataatgtcaag
aagcctattcaaaaatacaatgaccttttcgatttgtctgatgaggacgataacgacgac
aaagagatgtcagaagctgagtcttatatgttttccgatgaagctcctagtatagaaagt
ggaccagcaaatgcaaaatcaacacgggggatctatagtcaatctaacaaaaatatcata
cgtgatggaaagccgaactatagtttctctctcaaaaggaataattcggatgatgaaacg
gagcacacttctgcaataaaggcttcccttacaggtactactggctctaccaagcctaca
gtaaagtcgttttcagatatatttaatgttgatgatagtgcaagtgacgctgaaagtgat
tctgggacaggagggaacaattctaacggcttagtatccaatgattcagaaaggcaggtc
tccctgcaaagttctttgtatgaaaccaaatcagaatcccatcctcccaatcatcctcat
tcgcagattcttcaaacaccggctaagattgtaataactccaagcgtttctgatgcgcaa
tcacaagcccttgcaatcaccgatgatgatggtgaagatgatgatgatgacactagtagc
atactaagaactccgtttcaacttattgattcctctcattcacagcagccgcactatgcg
agcccacagtatacggctgtactcaatagcccccctcttccgccgccagctaggtctcaa
tcactaaaatatcatgacttaaattgcgatttagattcagaagtccccagaccaatgagt
aatctctttttcattgatgaagctgaggaagacgaatacaatcagaaaagtaagtttttt
gatttcgaccactacgacatcgatgaaattaatggcattccagaggattttaacttctct
gattctgaaagagatgatcttaatcgtcgtacactgaaatctcctttacggggcggctcc
aagaatagagaagtctctcctttttcatctgtgtcatcgtctttcagaagtacgcatagt
tttaatgggaaattaacgatcaaccaaggggctaaagaattagctccgatgaaaaataag
attgaacttacaaacaagactgtcaccttctttaacagtaataattggaatacttatgac
tgcaattcactctcccgaaaaacttcatcccaaatgagagatagtaaatatcaaaatcat
aatgttggtcaaaacgtagaaccttcaagtgttctttcgccacaacatcaaatatcgaat
ggtttagatggaaaatgcaatgataactacgtaatctcaccaaatttaccgacaactatc
acaccaactaattcatttactaaacccacaccggagttctcaaatgactactcattaagc
cctattcaggagacaccatcttctgttcaaagctcgccaaagagagcgtga

DBGET integrated database retrieval system