KEGG   Saccharomyces cerevisiae (budding yeast): YGL028CHelp
Entry
YGL028C           CDS       T00005                                 

Gene name
SCW11
Definition
(RefSeq) putative glucan endo-1,3-beta-D-glucosidase
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 852856
NCBI-ProteinID: NP_011487
SGD: S000002996
UniProt: P53189
Position
VII:complement(441281..442909)
Genome map
AA seq 542 aa AA seqDB search
MISPISFLSSLLCLTYLTSALPILPKREVVTRVHTASTTNVVTDFYSTTTEVVIAPTVEF
LISDSVTFTTTLIPQGVNPTAEPTTTITKVLLKKAEMSTSSQPTSTLQPSTIPQSTSSFQ
AESTLQAVSTQQTAMSVSAGTSEDVQQLATTSTSISSSPSPTTTSTSTQNIVSGVGEANV
EGNTQSQHHSYQAAATSTLNQQTSTSIASQESTESTNTPTSSSTSSSTSSSTSSSTSSST
SSSTSSSTSSSTSSSTSSTQETAATTSEGSSSSSAAITSSPKAIAYSPYNDDGSCKSADA
VSSDLTLIKSKGISKIRVYGTDCNSFETVQPAAVKLGIKINQGLYITSSGVDSIDDSVTT
LIQYGQTNGWDVFDFITVGNEAINNGWCSVSDLISKISSVKSKLSEAGYSGQITTSEPPV
SFENNPDLCKKSDIDFVGINPHAYFDTSASAETAGTFVKGQVELIQGVCGTSNVFVTETG
YPSSGIQNGGNIPSTANQITAVQNILNEMDLDVTILSTYNDYWKAPGDYGIEQSFGVIEY
FP
NT seq 1629 nt NT seq  +upstreamnt  +downstreamnt
atgatttcacccataagctttctatcatcgctgctatgcttaacttatctaacctcagct
ttaccgattcttcctaagagagaagttgtaacgagagttcacacagcaagcacaactaat
gttgtgactgatttttactccactactaccgaagttgttattgccccaactgtcgaattc
ctaataagcgatagtgttacctttacaacaaccttaattccacaaggtgtgaacccaaca
gctgaaccaactacgactatcactaaagttctcttaaaaaaggctgaaatgagtacatct
tcgcagccaacctctactttgcagccaagcactattccacaatcaacctcctcttttcaa
gcagaatctactttgcaagccgtctctacgcaacaaactgctatgtctgtttctgcaggt
actagtgaggatgtgcaacaattagctactacttctacctctatctcctcctctccttcc
cctaccactacgtctacttccacacaaaatatcgtgagtggtgtcggtgaagccaatgtt
gaaggcaacactcaaagtcagcatcattcttaccaagcagctgcgacttcaactttgaat
caacaaacgagtacctcaattgcttctcaggagtccaccgaatcaaccaatacacctacg
tcgtcctctacgtcgtcctctacttcttcttctacttcttcttctacttcttcctctact
tcttcttctacttcttcctctacttcgtcctctacttcgtcctctacttcatccacacag
gaaacagccgctaccacctctgaaggttcctctagtagcagcgctgctataacttcttct
ccaaaggctattgcatattcaccatataatgatgatggctcttgtaagtctgcagacgct
gtctcttctgacttaacgttgatcaaatctaaaggtatttccaaaatccgtgtttatggc
accgactgtaattcctttgaaaccgtccaaccagcagccgtaaaactaggtattaagatt
aaccaaggtttgtatatcaccagtagcggcgttgattccatagatgattctgttaccaca
ttgattcaatatggtcaaactaacggttgggatgtctttgatttcattactgttggaaat
gaagctatcaataatggttggtgttcagtttctgatttgattagtaaaatttcctctgtc
aaatccaaattaagcgaagctggctattctggccaaattactaccagtgagccccctgtc
tcatttgaaaataaccctgatttgtgcaaaaaatctgatattgacttcgttggtatcaac
ccacatgcctactttgatactagcgccagtgctgaaactgccggtacatttgttaagggt
caagttgaattaattcaaggtgtttgtggtacttctaatgttttcgtcacggaaacaggt
tacccatcgtctggtattcaaaatggaggcaacattccatccactgctaaccaaattact
gcagtccaaaacatcttgaatgaaatggacttggatgttacaatcttatcgacttacaat
gattactggaaggctcccggtgattacggtatcgaacaatctttcggtgtgattgaatat
tttccataa

DBGET integrated database retrieval system