KEGG   Saccharomyces cerevisiae (budding yeast): YHR143W-AHelp
Entry
YHR143W-A         CDS       T00005                                 

Gene name
RPC10, RPB12
Definition
(RefSeq) DNA-directed RNA polymerase core subunit RPC10
  KO
K03009  DNA-directed RNA polymerases I, II, and III subunit RPABC4
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce03020  RNA polymerase
Module
sce_M00180  RNA polymerase II, eukaryotes
sce_M00181  RNA polymerase III, eukaryotes
sce_M00182  RNA polymerase I, eukaryotes
Brite
KEGG Orthology (KO) [BR:sce00001]
 09120 Genetic Information Processing
  09121 Transcription
   03020 RNA polymerase
    YHR143W-A (RPC10)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03021 Transcription machinery [BR:sce03021]
    YHR143W-A (RPC10)
   03400 DNA repair and recombination proteins [BR:sce03400]
    YHR143W-A (RPC10)
Transcription machinery [BR:sce03021]
 Eukaryotic type
  RNA polymerase II system
   RNA polymerase II
    Pol I, II, III common subunits
     YHR143W-A (RPC10)
  RNA polymerase III system
   RNA polymerase III
     YHR143W-A (RPC10)
  RNA polymerase I system
   RNA polymerase I
     YHR143W-A (RPC10)
DNA repair and recombination proteins [BR:sce03400]
 Eukaryotic Type
  SSBR (single strand breaks repair)
   NER (nucleotide excision repair)
    TCR (transcription coupled repair) factors
     DNA-directed RNA polymerase II complex
      YHR143W-A (RPC10)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: DNA_RNApol_7kD Zn_ribbon_SprT HypA zinc-ribbons_6 UPF0547 Prok-RING_1 DZR C1_1 zinc_ribbon_10 DUF2318 Ribosomal_L40e TF_Zn_Ribbon
Motif
Other DBs
NCBI-GeneID: 856547
NCBI-ProteinID: NP_012013
SGD: S000001185
UniProt: P40422
Structure
PDB: 
1TWF 4C2M 3CQZ 1K83 1I50 3S14 2NVQ 6BM4 4C3I 3RZO 1TWC 3S1N 1I3Q 3S1M 4BY7 6HLQ 6HLR 3M3Y 6BLP 5OT2 3S1R 3S2D 3S17 3HOU 1TWA 6HLS 3S16 4C3H 4BXX 6EU3 4Y7N 3S1Q 3S2H 3S15 3RZD 3PO2 3PO3 1TWG 1I6H 6BQF 4C3J 2NVT 3GTL 6BM2 6BLO 6EU1 6EU2 5W51 5N61 4BBR 4A93 4A3D 4A3E 3HOY 2VUM 2YU9 2NVY 1TWH 2E2I 6HKO 3GTJ 4Y52 4A3B 4A3C 4A3F 4A3G 4A3K 4A3L 3HOV 2E2J 1R9T 5IP7 3M4O 6H67 5W4U 4BY1 4BBS 3HOW 2NVX 1SFO 3HOX 3HOZ 6F40 5C3E 4A3J 3I4M 3GTG 5W5Y 5U5Q 5M5W 5M3F 4A3I 3K7A 3GTK 3GTM 3GTQ 2R92 2R7Z 2JA5 2B63 1Y1V 1WCM 1PQV 3FKI 5W66 5IP9 5FJ8 4A3M 3I4N 3GTP 5C44 2E2H 4X6A 6EU0 5M5X 5M5Y 5M3M 5C4J 5C4X 3H3V 3GTO 2R93 2JA6 1Y1W 1Y1Y 6CNB 6CNC 4X67 1NIK 2B8K 6F44 5W64 5C4A 1NT9 1R9S 6F41 5W65 3QT1 3K1F 2NVZ 5FYW 6I84 5OA1 6CNF 1Y77 1R5U 6H68 5M64 5FJ9 5FJA 5OQJ 6GYL 6CND 5G5L 4BXZ 5LMX 6GYK 6F42 5OQM 5VVR 5FMF 5VVS 4V1M 6GYM 5N5Y 5N5Z 5N60 4V1N 5FZ5 4V1O 5SVA 3J1N 2JA7 2JA8
Thumbnails

Position
VIII:387233..387445
Genome map
AA seq 70 aa AA seqDB search
MSREGFQIPTNLDAAAAGTSQARTATLKYICAECSSKLSLSRTDAVRCKDCGHRILLKAR
TKRLVQFEAR
NT seq 213 nt NT seq  +upstreamnt  +downstreamnt
atgtctcgcgaagggttccagattccaacaaatttagacgccgcagctgcaggtacttct
caagctagaacggcaactttgaagtatatttgtgctgaatgttctagtaaattatcttta
tccagaactgatgcagtccgttgtaaggactgtggtcatagaatcctgttgaaggctagg
actaagagattggttcaatttgaagctagatga

DBGET integrated database retrieval system