KEGG   Saccharomyces cerevisiae (budding yeast): YLR087CHelp
Entry
YLR087C           CDS       T00005                                 

Gene name
CSF1
Definition
(RefSeq) Csf1p
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 850776
NCBI-ProteinID: NP_013188
SGD: S000004077
UniProt: Q12150
Position
XII:complement(306855..315731)
Genome map
AA seq 2958 aa AA seqDB search
MEAISQLRGVPLTHQKDFSWVFLVDWILTVVVCLTMIFYMGRIYAYLVSFILEWLLWKRA
KIKINVETLRVSLLGGRIHFKNLSVIHKDYTISVLEGSLTWKYWLLNCRKAELIENNKSS
SGKKAKLPCKISVECEGLEIFIYNRTVAYDNVINLLSKDERDKFEKYLNEHSFPEPFSDG
SSADKLDEDLSESAYTTNSDASIVNDRDYQETDIGKHPKLLMFLPIELKFSRGSLLLGNK
FTPSVMILSYESGKGIIDVLPPKERLDLYRNKTQMEFKNFEISIKQNIGYDDAIGLKFKI
DRGKVSKLWKTFVRVFQIVTKPVVPKKTKKSAGTSDDNFYHKWKGLSLYKASAGDAKASD
LDDVEFDLTNHEYAKFTSILKCPKVTIAYDVDVPGVVPHGAHPTIPDIDGPDVGNNGAPP
DFALDVQIHGGSICYGPWAQRQVSHLQRVLSPVVSRTAKPIKKLPPGSRRIYTLFRMNIS
IMEDTTWRIPTRESSKDPEFLKHYKETNEEYRPFGWMDLRFCKDTYANFNISVCPTVQGF
QNNFHVHFLETEIRSSVNHDILLKSKVFDIDGDIGYPLGWNSKAIWIINMKSEQLEAFLL
REHITLVADTLSDFSAGDPTPYELFRPFVYKVNWEMEGYSIYLNVNDHNIVNNPLDFNEN
CYLSLHGDKLSIDVTVPRESILGTYTDMSYEISTPMFRMMLNTPPWNTLNEFMKHKEVGR
AYDFTIKGSYLLYSELDIDNVDTLVIECNSKSTVLHCYGFVMRYLTNVKMNYFGEFFNFV
TSEEYTGVLGAREVGDVTTKSSVADLASTVDSGYQNSSLKNESEDKGPMKRSDLKRTTNE
TDIWFTFSVWDGALILPETIYSFDPCIALHFAELVVDFRSCNYYMDIMAVLNGTSIKRHV
SKQINEVFDFIRRNNGADEQEHGLLSDLTIHGHRMYGLPPTEPTYFCQWDINLGDLCIDS
DIEFIKGFFNSFYKIGFGYNDLENILLYDTETINDMTSLTVHVEKIRIGLKDPVMKSQSV
ISAESILFTLIDFENEKYSQRIDVKIPKLTISLNCVMGDGVDTSFLKFETKLRFTNFEQY
KDIDKKRSEQRRYITIHDSPYHRCPFLLPLFYQDSDTYQNLYGAIAPSSSIPTLPLPTLP
DTIDYIIEDIVGEYATLLETTNPFKNIFAETPSTMEPSRASFSEDDNDEEADPSSFKPVA
FTEDRNHERDNYVVDVSYILLDVDPLLFIFAKSLLEQLYSENMVQVLDDIEIGIVKRLSN
LQEGITSISNIDIHIAYLNLIWQETGEEGFELYLDRIDYQMSEKSLEKNRTNKLLEVAAL
AKVKTVRVTVNQKKNPDLSEDRPPALSLGIEGFEVWSSTEDRQVNSLNLTSSDITIDESQ
MEWLFEYCSDQGNLIQEVCTSFNSIQNTRSNSKTELISKLTAASEYYQISHDPYVITKPA
FIMRLSKGHVRENRSWKIITRLRHILTYLPDDWQSNIDEVLKEKKYTSAKDAKNIFMSVF
STWRNWEFSDVARSYIYGKLFTAENEKHKQNLIKKLLKCTMGSFYLTVYGEGYEVEHNFV
VADANLVVDLTPPVTSLPSNREETIEITGRVGSVKGKFSDRLLKLQDLIPLIAAVGEDDK
SDPKKELSKQFKMNTVLLVDKSELQLVMDQTKLMSRTVGGRVSLLWENLKDSTSQAGSLV
IFSQKSEVWLKHTSVILGEAQLRDFSVLATTEAWSHKPTILINNQCADLHFRAMSSTEQL
VTAITEIRESLMMIKERIKFKPKSKKKSQFVDQKINTVLSCYFSNVSSEVMPLSPFYIRH
EAKQLDIYFNKFGSNEILLSIWDTDFFMTSHQTKEQYLRFSFGDIEIKGGISREGYSLIN
VDISISMIKLTFSEPRRIVNSFLQDEKLASQGINLLYSLKPLFFSSNLPKKEKQAPSIMI
NWTLDTSITYFGVLVPVASTYFVFELHMLLLSLTNTNNGMLPEETKVTGQFSIENILFLI
KERSLPIGLSKLLDFSIKVSTLQRTVDTEQSFQVESSHFRVCLSPDSLLRLMWGAHKLLD
LSHYYSRRHAPNIWNTKMFTGKSDKSKEMPINFRSIHILSYKFCIGWIFQYGAGSNPGLM
LGYNRLFSAYEKDFGKFTVVDAFFSVANGNTSSTFFSEGNEKDKYNRSFLPNMQISYWFK
RCGELKDWFFRFHGEALDVNFVPSFMDVIESTLQSMRAFQELKKNILDVSESLRAENDNS
YASTSVESASSSLAPFLDNIRSVNSNFKYDGGVFRVYTYEDIETKSEPSFEIKSPVVTIN
CTYKHDEDKVKPHKFRTLITVDPTHNTLYAGCAPLLMEFSESLQKMIKKHSTDEKPNFTK
PSSQNVDYKRLLDQFDVAVKLTSAKQQLSLSCEPKAKVQADVGFESFLFSMATNEFDSEQ
PLEFSLTLEHTKASIKHIFSREVSTSFEVGFMDLTLLFTHPDVISMYGTGLVSDLSVFFN
VKQLQNLYLFLDIWRFSSILHTRPVQRTVNKEIEMSSLTSTNYADAGTEIPWCFTLIFTN
VSGDVDLGPSLGMISLRTQRTWLATDHYNEKRQLLHAFTDGISLTSEGRLSGLFEVANAS
WLSEVKWPPEKSKNTHPLVSTSLNIDDIAVKAAFDYHMFLIGTISNIHFHLHNEKDAKGV
LPDLLQVSFSSDEIILSSTALVVANILDIYNTIVRMRQDNKISYMETLRDSNPGESRQPI
LYKDILRSLKLLRTDLSVNISSSKVQISPISLFDVEVLVIRIDKVSIRSETHSGKKLKTD
LQLQVLDVSAALSTSKEELDEEVGASIAIDDYMHYASKIVGGTIIDIPKLAVHMTTLQEE
KTNNLEYLFACSFSDKISVRWNLGPVDFIKEMWTTHVKALAVRRSQVANISFGQTEEELE
ESIKKEEAASKFNYIALEEPQIEVPQIRDLGDATPPMEWFGVNRKKFPKFTHQTAVIPVQ
KLVYLAEKQYVKILDDTH
NT seq 8877 nt NT seq  +upstreamnt  +downstreamnt
atggaagctatttcacaattacgtggtgttccattgacacaccaaaaggactttagctgg
gtctttttagtagattggattctcacggtagtagtatgtttgacaatgatattctacatg
ggaagaatctatgcataccttgtaagttttatattagaatggctactatggaaacgagcg
aaaatcaagataaatgttgagacacttcgtgtctccttactaggtggtcgaatacatttt
aaaaacctttccgtaatacacaaagattatacaatttcggtattagagggtagtttaaca
tggaaatactggcttttaaattgcagaaaagcagaattgatagagaataacaagtcttct
tctggcaaaaaagcaaagcttccctgtaaaatttccgtagaatgtgaaggtctagaaatt
tttatttacaacagaacagtggcgtacgataatgttataaacttactatcaaaagatgaa
cgcgataaatttgaaaaataccttaatgagcattcttttcctgaaccttttagcgatgga
agtagtgctgataaattagatgaagatctaagcgaatctgcatacacaacgaactctgat
gcatcaattgttaatgacagggactaccaagaaacagatatcggcaaacatccaaagcta
ctgatgtttttaccaattgagcttaaatttagccgcggttccctactgttaggaaacaaa
ttcacgccatctgttatgattctaagttatgaaagtggaaaaggcataatagatgtttta
cctccaaaagagcgattagatttatacagaaataaaacacagatggaattcaaaaacttc
gaaatttctatcaaacaaaatattggttacgatgatgctattggattgaagtttaaaata
gatagagggaaagtgtcaaagttatggaaaacgtttgtacgagtctttcagatagtaacc
aagcctgttgtaccgaaaaagactaaaaaaagcgcaggcacatcagatgacaatttctat
cataaatggaaaggtttatctctttataaggcttctgcgggcgacgctaaagcaagtgat
ttagatgatgttgagttcgatttgacgaaccatgaatatgctaaatttacatcaatttta
aaatgcccaaaggtcacaattgcatatgacgtggatgttccgggcgttgtgccacatggt
gcacatccgacaatacctgatattgatggaccagatgtgggcaataacggagcacctcca
gattttgctttagatgttcaaattcacggaggatccatctgttacggaccttgggctcaa
agacaagtcagtcatctacaaagagttctatcaccggtagtttcaaggacagccaaacct
ataaaaaaactcccgccaggttctagaagaatatatacacttttcaggatgaatatatca
ataatggaagatactacttggcgtataccgacgagggaaagtagcaaagaccccgaattt
ttgaaacactacaaagaaactaatgaagaatataggccatttggatggatggatctccga
ttttgtaaggacacctatgcaaatttcaatataagtgtttgtcctacagtgcaaggtttt
cagaataatttccatgttcatttcctggaaaccgaaattaggtcaagtgttaatcacgat
attttgttaaaaagcaaggtattcgatattgatggggatattggatatccattgggttgg
aatagcaaagctatatggataattaacatgaagtcagaacaattagaggcgtttctgcta
cgtgagcatataactttagttgcagatacgctttcagacttttccgctggtgatcctacg
ccttacgaactttttagaccattcgtatacaaagtcaattgggaaatggaaggatattcc
atttacttaaacgtcaatgatcacaatattgttaacaatccgttagattttaacgaaaac
tgttatttatcccttcatggtgataagctttcaattgatgtcacggtaccccgtgagagt
attttggggacatacacagatatgtcctacgagatctcaactccaatgttcagaatgatg
ttaaatacccccccttggaatacattgaacgaattcatgaaacataaagaagtggggaga
gcatacgactttacaattaaaggttcttaccttctctattccgagttagatattgataat
gtcgatacgctagtcatagagtgtaacagcaagagtacagtacttcactgctatgggttt
gtcatgaggtatttaacaaacgtaaagatgaattacttcggtgaattttttaattttgtg
acgtcagaagagtacacaggtgtccttggcgctagggaagtcggagatgtcactacgaaa
agctcggtggcagatttggcatctactgtagattcagggtaccaaaatagcagtctaaag
aacgaatctgaggataaaggtcctatgaaaaggtcagatttgaaaaggactaccaacgaa
actgatatttggttcacattttcggtttgggatggtgctctgatattaccagaaacgatt
tacagttttgatccatgcattgcactacattttgccgaacttgtagtggatttcagaagt
tgtaattattatatggacataatggcggttctcaacgggacttcaataaagcggcacgtt
tcaaaacaaataaatgaagtatttgattttatacgtcgtaataacggagctgatgagcaa
gagcacggattgctttcggacctcaccattcatggacatagaatgtatggattaccaccc
acagaacctacctacttttgtcaatgggatatcaatctcggagatttatgcattgattca
gatattgaatttataaagggattctttaattccttttataagataggttttggctacaat
gacttggaaaatatattattatatgacactgagaccattaatgatatgacctcgctaacc
gtgcacgttgaaaaaataagaataggccttaaagatccggtgatgaaatctcaatcagtt
attagtgctgaatcgatattgtttactttgatcgactttgaaaacgaaaaatattcacaa
agaatagacgtgaaaattccaaaattgacaatttcgttaaattgcgtgatgggcgatggc
gtagacacatcatttctcaaattcgaaacaaaattaagatttacaaactttgagcaatac
aaggatatcgataaaaaaagatcagaacaacgcagatatataacaatacacgattcaccc
tatcataggtgtccttttcttcttccgctgttctatcaggattcggatacataccaaaac
ctgtacggggctatagcaccatcttcgtctatcccaactttacctcttcccactttgcct
gatactatagattatatcattgaagatattgtgggcgagtatgctacccttctggagacc
acaaatccattcaagaacatattcgcagaaactccatcaactatggagccttcaagagcc
agcttcagtgaagatgataatgacgaagaagcggacccttcaagcttcaaacctgtcgct
tttacagaagacagaaaccacgaaagggataactatgttgttgatgtttcatatattctg
ttggatgtcgacccgttgctttttattttcgctaagagtttattagaacagctttactct
gaaaacatggtacaagtcttagacgatattgaaattgggattgtgaaacgattaagcaac
cttcaagaagggatcacttctatttcaaacattgatatccatattgcttatctaaattta
atctggcaagagacaggtgaggaaggttttgagctctatttagatcgtattgattatcaa
atgagtgaaaagtctctagagaagaaccgaacaaataaattattagaagtagcagcttta
gcaaaggtaaaaactgtcagagtgactgttaaccagaagaaaaatccagacttgtctgaa
gatcgtccccctgcactgtcgctagggattgagggtttcgaagtatggtcttctacagaa
gatagacaagttaactcattaaacttaacgtcatcagatattaccatagacgaatctcaa
atggaatggctgtttgagtactgtagtgaccagggaaatcttattcaagaggtttgcact
tcttttaattctattcagaacaccagaagtaattcaaagacagaactcatttcaaagctc
acagccgcaagcgaatattatcaaattagtcatgatccttacgtcataacaaaacctgct
tttattatgagactttccaaagggcatgtgcgtgagaatcgtagttggaaaattattacg
cgtctgagacacattttaacgtaccttcctgatgattggcaaagcaacatcgacgaagtg
ctaaaagaaaagaaatatacctctgctaaagatgcaaaaaatatcttcatgtctgtgttt
tcgacttggagaaattgggagttctcagatgttgcaaggtcgtatatatacggcaaatta
ttcacggcagaaaatgagaaacataaacaaaatttgattaaaaaattgttgaagtgtacc
atgggatcattttaccttactgtttatggtgagggatatgaggttgagcataattttgtt
gttgcggatgccaatctggtagtggatttgacgcctccggtgacaagcttaccttcaaat
cgagaagaaactattgaaattacgggaagagtaggctcagtaaaaggaaaattcagtgat
aggttacttaaattgcaagatcttattccactcattgcagcagtgggcgaagatgacaaa
agtgatccaaaaaaggagttatcaaagcaattcaaaatgaacaccgttttattagtggat
aaaagtgaactgcaactggtcatggaccaaacgaagctgatgagtagaacagttgggggt
agagttagtttactatgggaaaatctaaaagattcaactagtcaagcgggttcattggtt
atattttcccagaaatcggaagtgtggttaaaacacacatctgtcattttgggagaagct
caactgcgcgacttttcagttttagcgactactgaggcatggtcacacaagcctacgatt
ctgataaacaaccagtgcgcagatcttcattttagagcaatgagttcaactgagcaatta
gtaaccgctattactgaaattagggaaagtctgatgatgattaaagagcgcataaagttt
aaacctaaatcaaagaaaaagtcccaatttgtcgaccagaaaattaatacagtcttgtca
tgttatttttcaaacgttagttctgaagttatgccgctctcgccattttatattcgtcac
gaagccaagcagcttgatatatattttaacaaattcggttcaaatgagattttgttaagc
atatgggatactgattttttcatgacatcgcaccagacaaaggagcaatacctaaggttt
tcatttggcgatattgaaattaaaggaggaatttctagagaaggctattcgttgataaac
gttgacatctcaatatctatgattaagttaaccttttcggagccgcgccgtattgtaaac
agttttttacaagatgaaaagcttgcttctcagggtatcaatctgttatattccctgaag
cctttattctttagttcaaatctaccaaaaaaagagaagcaggcaccctcgataatgata
aattggacattagatactagcattacttattttggtgttcttgtgccagtggcttccacg
tatttcgtgtttgaattacatatgctgctactttctctgaccaatacgaataacggtatg
ttaccagaagaaaccaaggtgacgggacagttttccatcgaaaacatcctatttctaata
aaggagcggtcactacccattggtctttccaaattactcgacttttccataaaagtatca
accctacaaagaacggttgatacggagcagtcattccaagtggaaagttctcatttcagg
gtctgcttatctcctgattctctattaagattaatgtggggcgcgcataaattgctagac
ttgagccattactattcaagacgccatgcccctaatatttggaacactaagatgttcacc
ggtaaaagtgataagtcaaaagaaatgcccataaatttccgttcaatacacatcctgtcc
tataaattttgtattgggtggatattccagtatggagcaggctccaatcctgggttaatg
ttaggttataacagattgttttcagcatatgaaaaggattttgggaaattcacagttgtg
gacgcttttttctctgttgcgaatggtaatacctcaagcacttttttctctgaaggaaac
gagaaagacaaatataatagaagtttcttgccaaacatgcaaatatcctactggttcaaa
agatgtggtgagttgaaagattggttttttagatttcatggtgaagcactggatgtaaac
tttgtcccgtcattcatggatgtcattgagtctactttacaatccatgcgagcatttcaa
gagctgaaaaagaacattctggatgtgtccgagagtttgcgtgcggaaaatgataattct
tatgctagtaccagtgtcgaaagtgcttcgagtagtttggctccctttctcgataacatt
agatctgttaactcaaatttcaagtatgacggtggtgtatttagggtttacacgtacgaa
gatattgaaaccaagagtgagccatcttttgaaataaaaagtccagtagtcactataaac
tgtacatataaacatgatgaagataaagttaagccacataaattcagaacattaatcact
gtcgacccaacgcataatactttgtatgcgggatgtgctcctttattaatggaattttct
gaaagtctgcaaaagatgataaagaaacatagcaccgacgaaaaaccaaactttacaaaa
ccttcttcacagaatgttgattataagcgacttttggatcaatttgatgtggctgtaaaa
ctaacatcagccaagcaacagctaagtttgagctgtgaaccaaaagctaaggttcaggca
gatgttggatttgaatcgtttttgttcagtatggctaccaatgagttcgactctgaacag
cctttggagttttctttaactctagaacacacaaaagcgtccattaagcacatattttca
agagaagtaagtacgtcctttgaagttggtttcatggacttgacgcttttatttacacat
cctgatgtaatcagtatgtatggaacggggttggtttctgatctaagcgtcttcttcaat
gtaaagcagctccagaacctgtatttattcttggacatatggaggttcagtagcatttta
cacacacggccagtgcaaagaactgttaataaggaaattgaaatgagttcattaacatca
accaactatgccgatgcaggtacggaaataccctggtgctttacattaatttttacaaat
gttagcggagacgttgatttgggtccttctctcggtatgatttcattaaggacacaaaga
acatggctggccacagatcattataacgagaagcggcagttactgcatgctttcactgac
ggtattagcttgacatcagaaggtagactgagtggtttatttgaagttgcgaatgcaagt
tggttatcagaagtaaaatggccacctgaaaaaagcaaaaatactcatccattagtttcc
acctccctgaatattgatgatatagcggtaaaggctgcttttgattatcatatgttctta
atcggcactataagtaacatacacttccatcttcataatgaaaaggatgccaagggggtt
ctacctgatttgctgcaggtctctttttcatcagatgaaattatcctcagctctactgca
ttagttgtagcaaatatactggatatctacaacaccattgtacgtatgaggcaggataat
aaaatatcgtatatggagacgttgagagattccaatcctggtgaatctaggcaaccaata
ttatacaaagacattttaagatcgctgaaattactcagaactgatctctcggtgaatatc
tcctcttcaaaggtccagatttcgccaatatctttattcgatgtggaagtgttagtaata
agaattgacaaagtctctatacgttccgaaacacattcggggaaaaaattaaagacagat
ttgcaactacaagttttagatgtttctgcagcgctttctacttccaaagaagaattagat
gaggaagttggagcttccattgctattgatgattacatgcattatgcttccaagattgtc
ggtggtactatcattgatattccaaaacttgctgttcatatgacaactttacaagaagaa
aagacaaataatttagaatatctatttgcttgctctttttcagacaaaatatctgtaagg
tggaatctagggcctgtagacttcataaaggaaatgtggactacacatgtcaaagcactg
gcagttcgtcgatcccaggtagcaaatatttcctttggacaaactgaggaagaacttgaa
gaatcaattaaaaaggaagaagccgcttcaaagtttaattatattgcactagaagaaccg
cagatcgaagtgcctcagataagagatctgggagacgccactccacctatggaatggttt
ggtgtcaatagaaaaaaatttccgaaattcactcaccaaaccgcagttatccccgtccaa
aagcttgtttatcttgcagaaaagcagtatgtcaagatactagatgatacgcattaa

DBGET integrated database retrieval system