KEGG   Saccharomyces cerevisiae (budding yeast): YMR124WHelp
Entry
YMR124W           CDS       T00005                                 

Gene name
EPO1
Definition
(RefSeq) Epo1p
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 855154
NCBI-ProteinID: NP_013843
SGD: S000004731
UniProt: P39523
Position
XIII:514456..517287
Genome map
AA seq 943 aa AA seqDB search
MDAGLSTMATRNGQSSARVKLRNNLLNNDIGNIDIRDETPISRNGNDSNINIQPSSVPQQ
QQQQQQYYRNGMNEAPIQAPLQQRQIPMQNYSQQQRQQQQYNFEYSNPHMNEIPLMQHNF
TKPSLSNNRDNVNGKKASSFTQSSFSNFFKHKHQFGKSKKNTKGTGGGGDGDDDDEVILD
DSANSDLTFNDIQTFGHKGGDKYGYGGDSTPIIPTLVTKDRGNMSNTEYRKYITNQRKTA
MNAMAKQTKNGTLASLPPRAMSLQSFPNGNPLMQAPTPHPRFQPNKMVSANYSRSNSLMS
GPPGQFRQPQQQRMLPMNNYNNHPGQFQNTPPVMPSGQQPPQQPRTLSLTNGPRYSPQNP
RPFAGHQQISQRQQQQQQQLQLHPMSEGYRTMSLQSQNVPQGFNPWSPNDNDRKAVSMKQ
PISQSSISSKNNSAYSIPNVQNNSLTTFSPSSPTDATAMPNSTKQGSSPLKKQVNIDQPI
ENKGKLNVLQLSTPQQNELKEKERKLAEMEKSLREREALVEEKEKERAEKNTEANEEEEI
SHESDDLNLRPASALETGLKDLKLESESAVANRASLSTFSSTFSDSPSKQRIINTRTGMY
KLENSTDINEYVTAQEFPSPGKYNSNSDNGEMNTTNEVDFDFNTSKRASLLQSIPERDPK
RNVSDATIKRRESDGNGRRLSNVNISMNQENINNDTFLYKKNNRDGHLSAVSHMSSSSRR
SFISNTLPLNIDSASESDNFVPHMDGSPSKTKSAPVSYDKDGMNASEEDFSFDNTLAKPY
EPLYARRGDITSAGSTSGEDSSQPKMITISGEQLNLITENKELMNELTLVSTELAESIKR
ETELEERIRLYETNNSAPSFDDSSSVSFSDFEKELRKKSSKIVQLIQQLNDERLKRFIAE
EQLLLQENGTKPSSMELVGRIENLNKLIDERDSEIEMLKGRLQ
NT seq 2832 nt NT seq  +upstreamnt  +downstreamnt
atggatgcaggtttatcgaccatggcaacaagaaacggtcagtcttctgctagagttaaa
ttgagaaataacctcttgaataatgatataggaaatattgacattagggatgaaacacct
atttcaaggaacgggaatgacagcaatattaacatccagccttcttccgtgccgcagcag
cagcagcagcagcagcaatactaccgtaatggcatgaatgaggctccaatacaagcgcca
cttcaacaacgtcaaattcccatgcagaattattcacaacagcaacgccagcaacaacag
tataattttgagtattccaatccacatatgaatgagattcccctcatgcagcataacttc
accaaaccatcactaagcaataatcgcgataatgttaatggtaagaaagcttcctcattt
acccagagctcattttccaattttttcaaacataagcatcaatttgggaagtcaaagaaa
aacactaaggggacaggaggtggtggagatggtgatgatgacgatgaggttatcttggat
gattctgcaaactccgacctaacattcaatgacattcagaccttcggtcacaagggcggt
gacaaatatggatatggtggtgattccactcctatcattccaacattggtgactaaagac
cgcggcaatatgagtaatactgagtataggaagtacattactaatcaaaggaaaaccgca
atgaatgccatggctaaacaaactaaaaatggtacattagcctcgttgcctccgagagca
atgtctttgcaaagtttcccgaatggtaatcctttaatgcaagcacccactcctcatcct
agatttcaaccgaataaaatggtgagcgctaattattcgagatcaaattcgttgatgagt
ggacctcccggacaatttcgacagccgcagcaacaaagaatgctaccgatgaacaactac
aacaatcacccaggtcaattccagaataccccaccagtaatgccctctggacaacagcca
cctcagcaaccacgtactctgtcattaactaatggcccaagatattcaccccaaaatcct
cggccattcgcaggtcatcagcagatatcacaaagacaacaacaacaacaacaacaactt
caacttcatccaatgtctgaaggctatcggacaatgtctctacaaagtcagaacgttccc
caagggtttaatccatggtcaccaaatgacaacgatcgtaaagctgtgtccatgaaacag
ccaatcagtcaatcgtcaatttcctcaaagaataattcagcttattcaataccgaacgta
caaaacaactccctgactacattctctccgtcatctcctactgatgctacagcaatgcct
aactctacaaaacaaggatcttcaccactaaaaaaacaagtgaacattgatcaacctatt
gaaaacaagggaaaactgaatgttttgcaattatccactcctcaacaaaacgagttaaag
gaaaaagaaaggaagctagctgaaatggaaaaatctttacgtgagagagaagcactagta
gaagaaaaagaaaaggaaagagctgagaaaaatactgaagcaaatgaagaggaggaaatt
tcacatgaatcagacgatttaaatttaagacctgcgagtgcgctagagactggtttaaaa
gatcttaaattggaaagtgaaagtgcagtcgccaatagagcgtccttgtcgactttctca
tccacatttagtgattctccctccaagcaaagaatcatcaataccagaacaggtatgtat
aagctagaaaactctactgatatcaatgaatacgtgaccgcacaagaattcccctctccc
ggaaagtataactcaaattcggataatggcgaaatgaatacaacgaacgaggtcgatttt
gatttcaatactagtaaaagggcttctttgttacaatccataccggaaagagatcccaaa
agaaatgtctcagatgctaccattaagcgacgtgaatccgatggcaatggcaggagacta
agtaatgtcaacatatccatgaaccaggaaaacatcaacaatgatacttttctatataaa
aaaaataatcgcgatggtcatttatcagcagtttctcatatgtccagctcttcccgtaga
tcgttcatctccaatacgctgccgttgaatattgattccgcctcagaatctgataatttt
gtaccgcatatggatggttcaccctccaaaacaaaatcagccccagttagctacgataag
gatggcatgaatgcttcagaagaagacttcagttttgataatactttagccaaaccgtat
gaaccgttatatgctaggagaggagacataacttccgccggatcaactagtggagaagat
agctctcagccaaagatgataacaatatctggtgagcaattgaatttgataacagaaaac
aaagaattaatgaatgagttgacactggtgtctacagaattagcagaatcgataaaaagg
gaaactgaattagaagaaagaatacggctgtatgaaaccaataattcagcaccatctttt
gacgattcttcgagtgtgtctttttctgactttgaaaaggaactgagaaaaaaatccagt
aaaattgtgcaattgatccagcaattaaatgacgagagattaaagagattcattgcggag
gagcagttattactccaagaaaatggcaccaaaccaagttctatggaactagtaggaaga
attgaaaacttgaataaacttattgatgagagagattcagaaattgaaatgcttaaagga
cgtttacagtag

DBGET integrated database retrieval system