KEGG   Saccharomyces cerevisiae (budding yeast): YNL166CHelp
Entry
YNL166C           CDS       T00005                                 

Gene name
BNI5
Definition
(RefSeq) Bni5p
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 855555
NCBI-ProteinID: NP_014233
SGD: S000005110
UniProt: P53890
Position
XIV:complement(322219..323565)
Genome map
AA seq 448 aa AA seqDB search
MGLDQDKIKKRLSQIEIDINQMNQMIDENLQLVEPAEDEAVEDNVKDTGVVDAVKVAETA
LFSGNDGADSNPGDSAQVEEHKTAQVHIPTENEANKSTDDPSQLSVTQPFIAKEQITHTA
IAIGDSYNSFVANSAGNEKAKDSCTENKEDGTVNIDQNRGEADVEIIENNDDEWEDEKSD
VEEGRVDKGTEENSEIESFKSPMPQNNTLGGENKLDAELVLDKFSSANKDLDIQPQTIVV
GGDNEYNHESSRLADQTPHDDNSENCPNRSGGSTPLDSQTKIFIPKKNSKEDGTNINHFN
SDGDGQKKMANFETRRPTNPFRVISVSSNSNSRNGSRKSSLNKYDSPVSSPITSASELGS
IAKLEKRHDYLSMKCIKLQKEIDYLNKMNAQGSLSMEDGKRLHRAVVKLQEYLDKKTKEK
YEVGVLLSRHLRKQIDRGENGQFWIGTK
NT seq 1347 nt NT seq  +upstreamnt  +downstreamnt
atgggcttggaccaggacaagataaagaagaggctttctcaaatagagatagatatcaac
cagatgaaccagatgattgacgaaaatttacaattagttgaacctgcggaggacgaagct
gtcgaagataatgtcaaggatacgggtgtggtcgacgctgtaaaggtggcagaaacggct
ctttttagtggcaatgatggagcggatagtaacccaggagattcagctcaggttgaagag
cacaaaaccgcacaggtccatattcccactgagaatgaagcgaataagagtacggatgac
ccatcccagctatcggttactcaaccttttatagcgaaagagcagataactcacaccgcc
attgctattggtgactcctataattcatttgtcgcaaattccgctggaaatgaaaaggca
aaggactcctgcactgagaacaaagaagatggtacagtcaatatagatcaaaacaggggt
gaagctgatgttgaaattatcgaaaataatgatgatgaatgggaggatgaaaaatcggat
gttgaagaggggcgagtagataagggaacagaggaaaacagtgagattgaatctttcaaa
tcacccatgccccagaataacaccttgggcggtgagaacaagttagacgctgaacttgta
ttagacaaattttcttccgctaataaggatctagatatacaaccgcaaaccatagttgta
ggaggtgacaatgaatacaaccatgagagcagccgtttagctgatcaaacaccccatgac
gataattcagagaattgtcccaatcgctctggaggaagcactcccttagattctcaaact
aaaatttttatccctaaaaagaattctaaagaagatggtaccaatataaatcactttaat
tcagatggtgatggacagaaaaaaatggcgaatttcgagacacgacgccctacaaatccg
ttcagagttatctcggtgagcagcaattccaattcaagaaacggaagtcgtaaatcttca
ctaaataagtatgattcgccagtctcctctcctatcacatcagcgtctgagctgggcagt
attgccaagctggaaaaaagacatgattatttatccatgaaatgcattaagttacaaaag
gaaattgactatctaaacaagatgaatgcacagggttctttatctatggaagacggaaag
agactacatagagccgtagtgaagcttcaagaatatcttgacaagaaaacgaaggagaaa
tatgaggtcggagtgttattaagtagacatctgagaaagcaaattgatcgtggcgaaaat
ggccaattttggattggaactaaatga

DBGET integrated database retrieval system