KEGG   Saccharomyces cerevisiae (budding yeast): YPL049CHelp
Entry
YPL049C           CDS       T00005                                 

Gene name
DIG1, RST1
Definition
(RefSeq) Dig1p
  KO
K11241  down-regulator of invasive growth 1
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce04011  MAPK signaling pathway - yeast
Brite
KEGG Orthology (KO) [BR:sce00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   04011 MAPK signaling pathway - yeast
    YPL049C (DIG1)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 856058
NCBI-ProteinID: NP_015276
SGD: S000005970
UniProt: Q03063
Position
XVI:complement(462481..463839)
Genome map
AA seq 452 aa AA seqDB search
MAVSARLRTTAEDTSIAKSTQDPIGDTEISVANAKGSSDSNIKNSPGGNSVGQESELEHV
PEEDDSGDKEADHEDSETATAKKRKAQPLKNPKKSLKRGRVPAPLNLSDSNTNTHGGNIK
DGNLASSNSAHFPPVANQNVKSAPAQVTQHSKFQPRVQYLGKASSRQSIQVNNSSNSYGK
PHMPSAGIMSAMNPYMPMNRYIMSPYYNPYGIPPPHMLNKPIMTPYVSYPYPMGPRTSIP
YAMQGGNARPYEENEYSASNYRNKRVNDSYDSPLSGTASTGKTRRSEEGSRNSSVGSSAN
AGPTQQRADLRPADMIPAEEYHFERDALLSANTKARSASTSTSTSTSTNRDRSSWHEAEP
NKDEEEGTDLAIEDGAVPTPTFTTFQRTSQPQQQSPSLLQGEIRLSSHIFAFEFPLSSSN
VDKKMFMSICNKVWNESKELTKKSSSHHRTGK
NT seq 1359 nt NT seq  +upstreamnt  +downstreamnt
atggccgtatcagcccgtttgagaacgactgccgaggatacatccattgctaaatcaaca
caagatccaattggtgatacagaaatcagtgtagcaaatgctaagggcagcagcgatagc
aacattaagaattcgccaggcggaaacagcgttggtcaggagtcggagctagagcatgtc
cctgaggaggatgactctggtgacaaggaagcagatcatgaggattctgagacagccact
gcgaagaagaggaaagcccaaccattgaagaatccgaagaaatcattgaagaggggcaga
gtcccggcgcctttgaatttatcggatagcaacactaatacacacggtggtaatattaag
gacggcaacttggcttcgtctaactctgcacattttcctcctgttgctaatcaaaacgtg
aaaagcgcgcccgcacaagttactcagcattccaagttccagccccgtgtccaatacttg
ggaaaggccagttctagacaatctatacaagtgaataatagcagcaatagttatgggaaa
ccacacatgccctcggcgggcatcatgagcgccatgaacccttacatgcccatgaatcgc
tacataatgtcaccatattataatccgtacggtatccctccacctcacatgctgaacaag
cccataatgacaccctacgtgtcgtatccatatccaatgggaccgcggacctccattcct
tatgctatgcaaggtggcaacgctaggccctacgaagaaaatgagtatagtgctagcaat
tacagaaacaagagggttaacgactcatatgattcgcctttgagtggcaccgcttccact
gggaaaaccagacgatccgaggaaggctcaagaaattctagcgtaggatcaagtgcgaat
gccggtcctacgcaacagcgcgcggatctacgcccagcagatatgatacctgctgaagaa
taccactttgaacgggatgcattactctcggccaacacgaaagccagaagcgcaagcaca
agcacaagtacaagcacaagcacaaaccgggacaggagttcatggcatgaggcagaaccc
aataaagacgaagaagagggtacggacttggccatcgaggacggagcggtccccactccc
acttttactacgttccagcggacctcgcagccgcagcagcaatcacctagtcttcttcaa
ggcgaaatccgactctcatcgcatatttttgccttcgagttccccctgagctctagcaat
gtagacaagaaaatgtttatgagcatatgtaataaagtatggaatgaatcaaaggagctg
acaaaaaaatcatcatcacatcacagaaccggaaaatag

DBGET integrated database retrieval system