KEGG   Saccharomyces cerevisiae (budding yeast): YPR171WHelp
Entry
YPR171W           CDS       T00005                                 

Gene name
BSP1
Definition
(RefSeq) Bsp1p
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 856301
NCBI-ProteinID: NP_015497
SGD: S000006375
UniProt: Q06604
Position
XVI:883828..885558
Genome map
AA seq 576 aa AA seqDB search
MTKYERDPELVNFLSKVEDLNSKRYSNIPSSKPAGEALSPVRSHNSGEYRRADMMTGKNV
EGCDNLAYRSAYNYEMTFSPKKTHYSLSELNLERITPRPDLEGSASQKEKKFLISEEDYL
LLQKLKASQTYNDSNADKNLPSFEKGPRMPSRGRPRPREKEIITIQYDFELPGRADIPSS
SSSSSPPPLPTRRDHIKITDGNEEKPLLPTRPNKAEVTESPSSRSIKPDAVVPERVKPAP
PVSRSTKPASFLSSLEDNKLTKAKSYNSEMETPKTTVKSSHIDYLDSIQLKPTTLSPTMK
NKPKPTPPSPPAKRIPRSESFIKSMLNSNLTTTSKPSLPEKPQKLRNANLAAHKTKPSIP
PKKVELNIVLPELRPVETSPTKQNFENSIDLPKLRSSNRNIKKEEEDSIPEAIKGIQNLK
KTKQQKPAIPQKKSFLTNNSKNTTLKNGDDINKLNDEIEALSLRNNLKKRPPTAPQRKIS
LPEALRKVELMKKSKTEPVLESSNELSINAKLDAIIASRNLRASNTLPELSGVNTNIATS
DKYTTSRDETVKETKPLVHPNKNRTRGPRRKLPTRV
NT seq 1731 nt NT seq  +upstreamnt  +downstreamnt
atgacaaaatatgagcgtgaccctgaattggtgaactttctatcgaaagtggaggatttg
aactctaagagatacagtaatattcctagttcaaaaccagcgggggaagcgctttcacca
gttagaagtcacaactctggggaatacagaagggctgatatgatgacagggaaaaatgtg
gaaggttgcgacaatttggcctaccgatctgcgtacaattatgaaatgacgttttctcca
aagaagactcattactcattaagtgagctgaatctcgaacgaataacgccaaggccggat
ttggagggaagtgcctctcaaaaagaaaaaaaatttttaatttctgaagaagattattta
ttattgcagaaattgaaagcctctcaaacatataatgattccaatgctgacaaaaatttg
ccttcctttgaaaaaggtcctcgtatgcccagtcggggtcgacccagaccgagagagaag
gaaataatcaccatccaatatgattttgaattaccaggaagagccgatataccctcctcc
tcctcttcttcatcaccaccgcctttgcccacaaggcgtgatcatatcaaaatcacagat
gggaatgaagagaaaccgcttcttccaacaaggcctaacaaagcagaagttacagaaagt
ccgtcatcaaggtcaataaaaccggatgctgtggtacctgagcgcgttaagcctgctcca
cctgtctcacgctctacaaaaccggcgagctttttaagttctttggaagataacaaattg
acaaaggcgaagagttataattcggaaatggaaactcccaaaacaactgtaaaaagttct
catatcgattacttggattccatacaactaaaaccaaccaccttatctcctacaatgaaa
aataaacctaaaccaacccctccttctccacctgcgaaaagaattccaagatctgaaagt
tttatcaagtctatgctaaactcgaatctcacgacaacttccaagccttctttgcctgaa
aaacctcaaaagctacggaatgcaaatttggccgcccataagaccaaaccaagcataccg
ccaaagaaagtggagttgaatatagtattacctgagctacgtcccgtagaaacttctcca
acaaagcagaacttcgaaaactcaatcgatttgcccaagttacgatccagcaaccgtaac
attaaaaaagaagaggaggacagtattccagaagcaataaaaggtatacaaaatctgaag
aaaaccaaacagcagaagcctgcaatccctcagaaaaaatcatttctaacaaataattcg
aaaaatactacactcaaaaatggtgatgatattaacaagttaaatgacgaaattgaagct
ctatcattgcggaataacctgaagaaacggccaccaacggcgccacaacgtaaaatttct
ttgccagaggcattgcgaaaagtcgaattgatgaaaaaatctaaaaccgagcctgtttta
gagtcctcaaacgaactgagcataaacgcaaaattagacgcaataattgcctctagaaac
ttaagagcatctaatactctaccagaacttagcggtgttaacactaatattgcaacttct
gacaagtatactacttctagagatgaaacagtgaaggaaactaaaccattagttcacccg
aataaaaataggactcgtggtcccagaagaaaacttccaacacgcgtgtaa

DBGET integrated database retrieval system