KEGG   Streptomyces coelicolor: SCO4744Help
Entry
SCO4744           CDS       T00085                                 

Gene name
acpS
Definition
(RefSeq) 4'-phosphopantetheinyl transferase
  KO
K00997  holo-[acyl-carrier protein] synthase [EC:2.7.8.7]
Organism
sco  Streptomyces coelicolor
Pathway
sco00770  Pantothenate and CoA biosynthesis
Brite
KEGG Orthology (KO) [BR:sco00001]
 09100 Metabolism
  09108 Metabolism of cofactors and vitamins
   00770 Pantothenate and CoA biosynthesis
    SCO4744 (acpS)
Enzymes [BR:sco01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.8  Transferases for other substituted phosphate groups
    2.7.8.7  holo-[acyl-carrier-protein] synthase
     SCO4744 (acpS)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: ACPS
Motif
Other DBs
NCBI-GeneID: 1100185
NCBI-ProteinID: NP_628902
Kitasato: SCO4744
UniProt: O86785
Structure
PDB: 

Position
complement(5158001..5158372)
Genome map
AA seq 123 aa AA seqDB search
MSIIGVGIDVAEVERFGAALERTPALAGRLFLESELLLPGGERRGVASLAARFAAKEALA
KALGAPAGLLWTDAEVWVEAGGRPRLRVTGTVAARAAELGVASWHVSLSHDAGIASAVVI
AEG
NT seq 372 nt NT seq  +upstreamnt  +downstreamnt
atgagcatcatcggggtcgggatcgacgtggccgaggtcgagcggttcggggcagcgctg
gagcgcacaccggccctggcggggcggctgttcctggagagcgagttgctgctgcccggc
ggggagcgccggggcgtggcctcgctcgccgcccggttcgcggcgaaggaggcgctggcc
aaggcgctgggcgcaccggcggggctgttgtggacggacgccgaggtgtgggtcgaggcc
ggcgggcggccgcggctgcgggtcacggggacggtggcggcgcgggcggcggagctgggc
gtggcgtcgtggcacgtgtcgctgagccacgacgcggggatcgcgtcggcggtggtgatc
gcggagggatag

DBGET integrated database retrieval system