KEGG   Secondary endosymbiont of Heteropsylla cubana: A35E_00064Help
Entry
A35E_00064        ncRNA     T02336                                 

Definition
(GenBank) Bacterial signal recognition particle RNA
  KO
K01983  SRP RNA
Organism
sehc  Secondary endosymbiont of Heteropsylla cubana
Pathway
sehc03060  Protein export
Brite
KEGG Orthology (KO) [BR:sehc00001]
 Genetic Information Processing
  Folding, sorting and degradation
   03060 Protein export
    A35E_00064
Non-coding RNAs [BR:sehc03100]
 Other RNA
  Signal recognition particle
   A35E_00064
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(130403..130496)
Genome map
NT seq 94 nt NT seq  +upstreamnt  +downstreamnt
gttcatgttctagcaacactgccttgtcaactcggtcaggtctggaaggaagcagccgta
acgagatatgtgtgtgagagatacttggagacac

DBGET integrated database retrieval system