KEGG   Secondary endosymbiont of Heteropsylla cubana: A35E_00100Help
Entry
A35E_00100        tRNA      T02336                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
sehc  Secondary endosymbiont of Heteropsylla cubana
Pathway
sehc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:sehc00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    A35E_00100
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:sehc03100]
    A35E_00100
Non-coding RNAs [BR:sehc03100]
 Transfer RNA
  tRNA
   A35E_00100
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(193388..193459)
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
gcgggaatagctcagtggtagagcacaaccttgccaaggttggggtcgcgagttcgagcc
tcgtttcccgct

DBGET integrated database retrieval system