KEGG   Salmonella enterica subsp. enterica serovar Gallinarum/pullorum RKS5078: SPUL_1936
Entry
SPUL_1936         gene      T01740                                 

Gene name
ycdC
Definition
(GenBank) pseudogene
Organism
sel  Salmonella enterica subsp. enterica serovar Gallinarum/pullorum RKS5078
SSDB
Position
complement(1931146..1931538)
NT seq 393 nt   +upstreamnt  +downstreamnt
gcgtttcgcgcagaattttcccctctggaggccatcaaagagtatatccgtctcaagctg
gaggtttcgcgtgattatccgcaggcgtcgcggctcttctgcatggagatgctggcgggc
gcgccgctcttaatggaggaactgaccggcgatctaaaagcgttgatagatgaaaaatcc
gcgctgattgccggatgggtgcacagcgggaaactggcgcccgtctccccgcaccatttg
atcttcatgatttgggccgccacgcaacattacgccgattttgcccctcaggttgaggcg
gtaaccggcgcgacgcttcgcgatgaagcctttttcaaccaaacggtcgaaagcgttcag
cgcattattattgaagggattcgcgtgcgttaa

DBGET integrated database retrieval system