KEGG   Salmonella enterica subsp. enterica serovar Gallinarum/pullorum RKS5078: SPUL_2006
Entry
SPUL_2006         gene      T01740                                 

Definition
(GenBank) pseudogene
Organism
sel  Salmonella enterica subsp. enterica serovar Gallinarum/pullorum RKS5078
SSDB
Position
2000564..2000682
NT seq 119 nt   +upstreamnt  +downstreamnt
atgttattccgttcccacggaccccacgcaacgccagcttctgatttttacgtcacactc
aaggccagctatgctggcttttttttcgcctgaatgtcagctttattatcaataagtaa

DBGET integrated database retrieval system