KEGG   Salmonella enterica subsp. enterica serovar Gallinarum/pullorum RKS5078: SPUL_t023
Entry
SPUL_t023         tRNA      T01740                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
sel  Salmonella enterica subsp. enterica serovar Gallinarum/pullorum RKS5078
Pathway
sel00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:sel00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    SPUL_t023
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:sel03100]
    SPUL_t023
Non-coding RNAs [BR:sel03100]
 Transfer RNA
  SPUL_t023
SSDB
Position
complement(1962528..1962612)
NT seq 85 nt   +upstreamnt  +downstreamnt
ggaagtgtggccgagcggttgaaggcaccggtcttgaaaaccggcgacccgaaagggttc
cagagttcgaatctctgcgcttccg

DBGET integrated database retrieval system