KEGG   Staphylococcus epidermidis RP62A: SERP2219Help
Entry
SERP2219          gene      T00229                                 

Definition
(GenBank) pseudogene
Organism
ser  Staphylococcus epidermidis RP62A
SSDB OrthologParalogGene clusterGFIT
Position
2256196..2256869
Genome map
NT seq 674 nt NT seq  +upstreamnt  +downstreamnt
atgaactatttcagatataaacaatttaacaaagatgttatcactgtagccgttggctac
tatctaagatatgcattgagttatcgtgatatatctgaaatattaagggaacgtggtgta
aacgttcatcattcaacggtctaccgttgggttcaagaatatgtctcaattttatatcaa
atttggaagaaaagcatcaaaaagcttattacaaatggcgtattgatgagacgtacatca
aaataaaaggaaaatggagctatttatatcgtgccattgatgcagagggacatacattag
atatttggttgcgtaagcaacgagataatcattcagcatatgcgtttatcaaacgtctca
ttaaacaatttggtaaacctcaaaaggtaattacagatcaggcaccttcaacgaaggtag
caatggctaaagtaattaaagcttttaaacttaaacctgactgtcattgtacatcgaaat
atctgaataacctcattgagcaagatcaccgtcatattaaagtaagaaagacaaggtatc
aaagtatcaatacagcaaagaatactttaaaaggtattgaatgtatttacgctctatata
aaaagaaccgcaggtctcttcagatctacggattttcgccatgccacgaaattagcatca
tgctagcgagttaa

DBGET integrated database retrieval system