KEGG   Salmonella enterica subsp. enterica serovar Typhimurium SL1344: SL1344_0001Help
Entry
SL1344_0001       CDS       T01724                                 

Gene name
thrL
Definition
(GenBank) thr operon leader peptide
  KO
K08278  thr operon leader peptide
Organism
sey  Salmonella enterica subsp. enterica serovar Typhimurium SL1344
Brite
KEGG Orthology (KO) [BR:sey00001]
 09190 Not Included in Pathway or Brite
  09192 Unclassified: genetic information processing
   99973 Transcription
    SL1344_0001 (thrL)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Leader_Thr
Motif
Other DBs
NCBI-ProteinID: CBW16102
UniProt: A0A0H3N791
Position
169..255
Genome map
AA seq 28 aa AA seqDB search
MTEYTTSMNRISTTTITTITITTGNGAG
NT seq 87 nt NT seq  +upstreamnt  +downstreamnt
atgacagagtacacaacatccatgaaccgcatcagcaccaccaccattaccaccatcacc
attaccacaggtaacggtgcgggctga

DBGET integrated database retrieval system