KEGG   Spirochaeta africana: Spiaf_0315Help
Entry
Spiaf_0315        tRNA      T01811                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
sfc  Spirochaeta africana
Pathway
sfc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:sfc00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Spiaf_0315
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:sfc03100]
    Spiaf_0315
Non-coding RNAs [BR:sfc03100]
 Transfer RNA
  tRNA
   Spiaf_0315
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(392858..392931)
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
gctccggtagctcagcaggatagagcgagtgcctcctaagcactaggtcggacgttcgaa
tcgtctccggggca

DBGET integrated database retrieval system