KEGG   Streptococcus gordonii: SGO_1178Help
Entry
SGO_1178          CDS       T00594                                 

Definition
(GenBank) lipoprotein, putative
Organism
sgo  Streptococcus gordonii
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: O-antigen_lig LPAM_1 SICA_C Peptidase_S49_N DUF1510
Motif
Other DBs
NCBI-ProteinID: ABV09149
UniProt: A8AXF5
Position
complement(1229087..1229425)
Genome map
AA seq 112 aa AA seqDB search
MKKIATLTIAGLTIFTLAACSNQKSDSDMKKMDDSSMMKKEDMKKEDMKKDDMKKDEMKD
SSMSDDKMKKDDMKDSSMMSDSKSDMKDDMKKDEMKSSDSDMKDSSEMSSDK
NT seq 339 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaaatcgctacacttacaatcgctggacttactatctttactttagcagcctgc
tctaatcaaaaatcagattctgacatgaagaagatggatgacagcagtatgatgaaaaaa
gaagacatgaaaaaagaagacatgaaaaaagatgacatgaagaaggacgaaatgaaagac
tctagcatgtcagatgataagatgaaaaaggatgatatgaaggactcttctatgatgtct
gatagtaagtctgacatgaaagatgatatgaagaaagacgaaatgaagtcaagtgattca
gatatgaaggattcgtcagaaatgtcttctgacaaataa

DBGET integrated database retrieval system