KEGG   Streptomyces griseus: SGR_2639Help
Entry
SGR_2639          CDS       T00691                                 

Definition
(GenBank) conserved hypothetical protein
Organism
sgr  Streptomyces griseus
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PspC DUF2770
Motif
Other DBs
NCBI-ProteinID: BAG19468
Kitasato: SGR2639
UniProt: B1W2V4
Position
3120601..3120807
Genome map
AA seq 68 aa AA seqDB search
MAALVRPREGRMIGGVCAGLARRFGISANTMRVIFVVSCLLPGPQFLLYLALWALLPTEK
SASSATAW
NT seq 207 nt NT seq  +upstreamnt  +downstreamnt
atggccgcacttgtccgcccccgcgaaggccgcatgatcggcggagtgtgcgcgggcctc
gcccggcgcttcggtatctccgccaacacgatgcgcgtcatcttcgtcgtctcctgtctg
ctgcccggcccgcagttcctgctctacctggcgctgtgggcgctgctgccgacggagaag
tccgcttcctccgcgacggcctggtga

DBGET integrated database retrieval system