KEGG   Streptomyces griseus: SGR_5936Help
Entry
SGR_5936          CDS       T00691                                 

Gene name
strH
Definition
(GenBank) putative dTDP-dihydrostreptose--streptidine-6-phosphate dihydrostreptosyltransferase
  KO
K04341  dTDP-dihydrostreptose-streptidine-6-phosphate dihydrostreptosyltransferase [EC:2.4.2.27]
Organism
sgr  Streptomyces griseus
Pathway
sgr00521  Streptomycin biosynthesis
sgr01100  Metabolic pathways
sgr01110  Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:sgr00001]
 09100 Metabolism
  09110 Biosynthesis of other secondary metabolites
   00521 Streptomycin biosynthesis
    SGR_5936 (strH)
Enzymes [BR:sgr01000]
 2. Transferases
  2.4  Glycosyltransferases
   2.4.2  Pentosyltransferases
    2.4.2.27  dTDP-dihydrostreptose---streptidine-6-phosphate dihydrostreptosyltransferase
     SGR_5936 (strH)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: BAG22765
Kitasato: SGR5936
UniProt: B1W383
Position
6945101..6946255
Genome map
AA seq 384 aa AA seqDB search
MVMTSPTRKPSGDVRPDEPLHHLDQPFREFLDGLPADRPPWFCFFSSGLLHVLHHFLRFT
PERLNCVFICSGLSKEEAELRDRMSGGRPVFDMTEQVGSHEIFELLVRNLDRPFGIVDVD
CFVTETDWFERCMDGLEPGVAVSGPLSYGPIPLAAPPFLALDPRVRPDIERAIGGTVTPA
AYSYTAPGPEKEIDGAMVRLIEPHHERALARVVALEGPRLPFPQGGLVDVLDDGREVRSH
ERYHHLQNGNEVIRVVFDGLMFYQLMALAAGLRIAHFHSFPGTKVFAPQLVHAGGISYWH
RLRPSEIAAGINELPWAAHVDALLLEEFNRRADVPASYRTRGTRLAANLRRSMVDMAGLR
DELRAKLDSSGVDVTDPRWAVVLG
NT seq 1155 nt NT seq  +upstreamnt  +downstreamnt
atggtgatgacctccccgacccggaaaccttcgggcgacgtacgccccgacgaacccctg
caccacctggaccagccgttccgggagttcctcgacggacttccggcggaccgccccccg
tggttctgcttcttctcgtccgggctgctgcacgtcctccaccacttcctgcgcttcacc
cccgagcggttgaactgcgtgttcatctgctccggactgagcaaggaggaggccgagctc
cgcgaccggatgagcggtggcaggcccgtcttcgacatgacggagcaggtcggcagccac
gagatcttcgagctcctggtgcgcaacctggaccggccgttcggcatcgtcgacgtcgac
tgcttcgtcacggaaaccgactggttcgagcgctgcatggacgggttggagccgggcgtc
gccgtcagcggtccgctcagctacggtccgatcccgttggccgcgcccccgttcctggcc
ctcgacccgcgggtgcgccccgacatcgagcgcgccatcggcggcaccgtcacacccgcc
gcgtactcctacaccgctcccggcccggagaaggagatcgacggcgcgatggtgcggctc
atcgaaccgcatcacgagagggccctggcccgggtggtggccctggagggaccgcgcctg
ccgtttccgcagggcggcctggtcgacgtgctcgacgacggccgggaagtgcgcagccac
gagcgctaccaccacctccagaacggcaacgaagtgatccgcgtcgtcttcgacggcctg
atgttctaccagctgatggcgttggcggcggggctgcgcatcgcccacttccacagcttc
cccggcaccaaggtcttcgccccccaactggtccacgcgggcggcatctcgtactggcac
cggctgcggcccagcgagatcgcggccggcatcaacgaactgccctgggccgcgcacgtc
gacgcgctgctgctggaggagttcaacaggagggcggacgtccccgcgagctaccggacc
cgcggcacccgcctcgccgcgaacctgcgccggtccatggtcgacatggccgggctccgc
gacgaactgcgcgccaagctcgactcgtccggggtggacgtgaccgacccccgatgggcc
gtcgtcctcggttga

DBGET integrated database retrieval system