KEGG   Sulfurospirillum halorespirans: SHALO_0467Help
Entry
SHALO_0467        tRNA      T04475                                 

Definition
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
shal  Sulfurospirillum halorespirans
Pathway
shal00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:shal00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    SHALO_0467
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:shal03100]
    SHALO_0467
Non-coding RNAs [BR:shal03100]
 Transfer RNA
  SHALO_0467
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
476398..476473
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gctggtgtagctcagttggtagagcaactgccttgtaagcagtaggtcggcggttcgact
ccgttcaccagctcca

DBGET integrated database retrieval system