KEGG   Shewanella sp. ANA-3: Shewana3_1284Help
Entry
Shewana3_1284     CDS       T00428                                 

Definition
(GenBank) putative conjugal transfer trbD transmembrane protein
  KO
K20529  type IV secretion system protein TrbD
Organism
shn  Shewanella sp. ANA-3
Pathway
shn02024  Quorum sensing
Brite
KEGG Orthology (KO) [BR:shn00001]
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    Shewana3_1284
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   02044 Secretion system [BR:shn02044]
    Shewana3_1284
Secretion system [BR:shn02044]
 Type IV secretion system
  Trb secretion system protein
   Shewana3_1284
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: VirB3
Motif
Other DBs
NCBI-ProteinID: ABK47518
UniProt: A0KUP9
Position
1494983..1495252
Genome map
AA seq 89 aa AA seqDB search
MSTANDLPGFEVPLHRSLTEPILLGGAPRTVAIANGTLAAAVGLGLQLWIPGVVLWIVGH
SLAVWGARVDPQFMQVFARHIKHKPLLDV
NT seq 270 nt NT seq  +upstreamnt  +downstreamnt
atgagcacggccaacgatcttcccggcttcgaggtgccgctgcatcgctcgctgaccgag
ccaatcctgcttggtggtgcgccgcgcacggtcgccattgcgaacggcacgctggccgcc
gccgtggggctgggcctgcaactgtggattcccggcgtggtgctctggatcgtcggccat
tcgctggccgtatggggcgcgcgtgtcgatccgcagttcatgcaggtcttcgcccggcac
atcaagcacaagccgctgctggacgtgtga

DBGET integrated database retrieval system