KEGG   Sinorhizobium medicae: Smed_0555Help
Entry
Smed_0555         CDS       T00555                                 

Definition
(RefSeq) hypothetical protein
Organism
smd  Sinorhizobium medicae
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 5321391
NCBI-ProteinID: YP_001326246
UniProt: A6U6Y1
Position
603813..603956
Genome map
AA seq 47 aa AA seqDB search
MSKEPIFTPREILIWITILGSVVGYQLWSHADPQPLTLDLATIERRA
NT seq 144 nt NT seq  +upstreamnt  +downstreamnt
atgtcgaaggaaccgatcttcacaccccgtgaaattctcatctggataacgatccttggc
agcgtggtcggctatcagctgtggagccatgccgatccgcagccactgacgctcgatctc
gctacgatcgagcggcgcgcctga

DBGET integrated database retrieval system