KEGG   Sinorhizobium medicae: Smed_4456Help
Entry
Smed_4456         CDS       T00555                                 

Definition
(RefSeq) hypothetical protein
Organism
smd  Sinorhizobium medicae
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 5317926
NCBI-ProteinID: YP_001313190
UniProt: A6UHX7
Position
pSMED01:939773..940009
Genome map
AA seq 78 aa AA seqDB search
MVSEPTVADAINRIYESLQADNADIDTHIATLKAALTREGLKEAVFDPARLVQNNRSGRK
LMQAYFRQRGVTVKYSAS
NT seq 237 nt NT seq  +upstreamnt  +downstreamnt
atggtgagcgaaccgaccgtcgcagatgcaataaaccgcatttatgaatcgctccaagcg
gacaatgccgacatcgacacgcatatcgcgactctcaaggcagcgttgacgcgcgagggg
ttgaaagaggccgtctttgacccggcgaggctcgtgcagaacaaccgttctggcaggaag
ctcatgcaggcctactttcggcagcgcggcgtaacggtcaaatactcggcttcgtga

DBGET integrated database retrieval system