KEGG   Sinorhizobium medicae: Smed_4464Help
Entry
Smed_4464         gene      T00555                                 

Definition
(RefSeq) pseudogene
Organism
smd  Sinorhizobium medicae
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 5317934
Position
pSMED01:945180..945374
Genome map
NT seq 195 nt NT seq  +upstreamnt  +downstreamnt
ttcgccgccctgatgcgcgagaacatcgcgaacggccctgtgccgtttcgccgtgcatat
ttacgcgccgtgatcgattaggttgaagttgatgacggggagatcagaattcacggtcgc
aagagcgagcttgagcgccttgtgatgacgaagaacagcgtcatcatggcagcagtgccc
agttttgtacggaag

DBGET integrated database retrieval system