KEGG   Streptococcus pneumoniae TCH8431/19A (serotype 19A): HMPREF0837_t10054
Entry
HMPREF0837_t10054 tRNA      T01259                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
snc  Streptococcus pneumoniae TCH8431/19A (serotype 19A)
Pathway
snc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:snc00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    HMPREF0837_t10054
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:snc03100]
    HMPREF0837_t10054
Non-coding RNAs [BR:snc03100]
 Transfer RNA
  HMPREF0837_t10054
SSDB
Position
complement(2083611..2083692)
NT seq 82 nt   +upstreamnt  +downstreamnt
gcgggtttggcggaattggcagacgcaccagatttaggatctggcgcttaacggcgtggg
ggttcaagtcccttaacccgca

DBGET integrated database retrieval system