KEGG   Streptococcus pneumoniae TCH8431/19A (serotype 19A): HMPREF0837nc10001
Entry
HMPREF0837nc10001 ncRNA     T01259                                 

Definition
(GenBank) similar to 5.8S ribosomal RNA
Organism
snc  Streptococcus pneumoniae TCH8431/19A (serotype 19A)
SSDB
Position
complement(60163..60314)
NT seq 152 nt   +upstreamnt  +downstreamnt
aagggcgcacggtggatgccttggcactaggagccgacgaaggacgtgacaaacgacgat
ataccttgggtagctgtaagtaagcgatgatccagggatttccgaatgggggaacccaac
aggtaatacctgttacccacatctgttaagga

DBGET integrated database retrieval system