KEGG   Streptococcus pyogenes NZ131 (serotype M49): Spy49_tRNAleu6Help
Entry
Spy49_tRNAleu6    tRNA      T00780                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
soz  Streptococcus pyogenes NZ131 (serotype M49)
Pathway
soz00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:soz00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Spy49_tRNAleu6
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:soz03100]
    Spy49_tRNAleu6
Non-coding RNAs [BR:soz03100]
 Transfer RNA
  tRNA
   Spy49_tRNAleu6
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1247682..1247763)
Genome map
NT seq 82 nt NT seq  +upstreamnt  +downstreamnt
gcgggtttggcggaattggcagacgcaccagatttaggatctggcgcttaacggcgtggg
ggttcaagtcccttaacccgca

DBGET integrated database retrieval system