KEGG   Streptococcus pyogenes MGAS6180 (serotype M28): M28_Spy1309Help
Entry
M28_Spy1309       CDS       T00263                                 

Definition
(GenBank) hypothetical protein
Organism
spb  Streptococcus pyogenes MGAS6180 (serotype M28)
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Hol_Tox
Motif
Other DBs
NCBI-ProteinID: AAX72419
UniProt: Q48S91
Position
1291723..1291866
Genome map
AA seq 47 aa AA seqDB search
MGNSSKSNRKEELDLSTFEVLTLMFIAGNFVIALVKLVLELVKSTKK
NT seq 144 nt NT seq  +upstreamnt  +downstreamnt
atgggcaattcatcaaaatccaacagaaaggaggagctagatttgtctacctttgaggtc
ttaacactcatgtttatagcaggtaacttcgttatcgctctcgtgaagttagtccttgaa
ctggtaaaatcgacaaaaaaataa

DBGET integrated database retrieval system