KEGG   Streptococcus pyogenes MGAS10270 (serotype M2): MGAS10270_Spy1384Help
Entry
MGAS10270_Spy1384 CDS       T00355                                 

Definition
(GenBank) hypothetical protein
Organism
sph  Streptococcus pyogenes MGAS10270 (serotype M2)
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Hol_Tox
Motif
Other DBs
NCBI-ProteinID: ABF34449
UniProt: Q1JFW0
Position
1317624..1317767
Genome map
AA seq 47 aa AA seqDB search
MGNSSKSNRKEELDLSTFEVLTLMFIAGNFVIALVKLVLELVKSTKK
NT seq 144 nt NT seq  +upstreamnt  +downstreamnt
atgggcaattcatcaaaatccaacagaaaggaggagctagatttgtctacctttgaggtc
ttaacactcatgtttatagcaggtaacttcgttatcgctctcgtgaagttagtccttgaa
ctggtaaaatcgacaaaaaaataa

DBGET integrated database retrieval system