KEGG   Streptococcus pyogenes MGAS10750 (serotype M4): MGAS10750SpyR2281Help
Entry
MGAS10750SpyR2281 tRNA      T00356                                 

Definition
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
spi  Streptococcus pyogenes MGAS10750 (serotype M4)
Pathway
spi00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:spi00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    MGAS10750SpyR2281
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:spi03100]
    MGAS10750SpyR2281
Non-coding RNAs [BR:spi03100]
 Transfer RNA
  tRNA
   MGAS10750SpyR2281
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1329987..1330057
Genome map
NT seq 71 nt NT seq  +upstreamnt  +downstreamnt
gccgctgtagttaaatggtataataaagcaatggtaatgcttcgttccgagttcgattct
cggtggtggca

DBGET integrated database retrieval system