KEGG   Streptococcus pyogenes MGAS9429 (serotype M12): MGAS9429_Spy1113Help
Entry
MGAS9429_Spy1113  CDS       T00358                                 

Definition
(GenBank) D-alanyl carrier protein
  KO
K14188  D-alanine--poly(phosphoribitol) ligase subunit 2 [EC:6.1.1.13]
Organism
spk  Streptococcus pyogenes MGAS9429 (serotype M12)
Pathway
spk00473  D-Alanine metabolism
spk01100  Metabolic pathways
spk01503  Cationic antimicrobial peptide (CAMP) resistance
spk02020  Two-component system
Brite
KEGG Orthology (KO) [BR:spk00001]
 09100 Metabolism
  09106 Metabolism of other amino acids
   00473 D-Alanine metabolism
    MGAS9429_Spy1113
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    MGAS9429_Spy1113
 09160 Human Diseases
  09175 Drug resistance: antimicrobial
   01503 Cationic antimicrobial peptide (CAMP) resistance
    MGAS9429_Spy1113
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   01504 Antimicrobial resistance genes [BR:spk01504]
    MGAS9429_Spy1113
Enzymes [BR:spk01000]
 6. Ligases
  6.1  Forming carbon-oxygen bonds
   6.1.1  Ligases forming aminoacyl-tRNA and related compounds
    6.1.1.13  D-alanine---poly(phosphoribitol) ligase
     MGAS9429_Spy1113
Antimicrobial resistance genes [BR:spk01504]
 Gene sets
  CAMP resistance modules
   Cationic antimicrobial peptide (CAMP) resistance, dltABCD operon [MD:M00725]
    MGAS9429_Spy1113
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PP-binding PP-binding_2
Motif
Other DBs
NCBI-ProteinID: ABF32300
UniProt: Q1JLB9
Position
complement(1069240..1069479)
Genome map
AA seq 79 aa AA seqDB search
MSIEETVIELFDRLFMEDVSEMMDEDLFDAGVLDSLGTVELIVELESTFNIKVPISEFGR
DDWNTVTKIVQGVEELQHA
NT seq 240 nt NT seq  +upstreamnt  +downstreamnt
atgtctattgaagaaactgtaattgaattatttgaccgtttgtttatggaagatgtttca
gagatgatggacgaagacttgtttgatgcaggtgtgttggatagtcttgggacagtcgaa
ttgattgttgagttagagtcaacgttcaatattaaagtacctatttcagaatttggtcgt
gatgattggaacacagtaactaagattgttcaaggtgtagaggaattgcaacatgcttaa

DBGET integrated database retrieval system