KEGG   Shewanella pealeana: Spea_2005Help
Entry
Spea_2005         CDS       T00606                                 

Definition
(GenBank) malate synthase
  KO
K01638  malate synthase [EC:2.3.3.9]
Organism
spl  Shewanella pealeana
Pathway
spl00620  Pyruvate metabolism
spl00630  Glyoxylate and dicarboxylate metabolism
spl01100  Metabolic pathways
spl01110  Biosynthesis of secondary metabolites
spl01120  Microbial metabolism in diverse environments
spl01200  Carbon metabolism
Module
spl_M00012  Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:spl00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Spea_2005
   00630 Glyoxylate and dicarboxylate metabolism
    Spea_2005
Enzymes [BR:spl01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Spea_2005
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABV87325
UniProt: A8H438
Position
2428976..2429491
Genome map
AA seq 171 aa AA seqDB search
MDISTTNTSTQVNNNNGHYIGAELVDVKLVEVASNDVTALSAKDFLDAKFPLANGSHKNA
CSYVIYYQQLLVFMADGSQTGLRQPKQFVALNGHKSEPTAILLKDKGGHVELTFDRSKAN
TNRDLANLQDIQLEGHEYWISLINIENTVVASSMQDQVFTAKDGSDYLLKS
NT seq 516 nt NT seq  +upstreamnt  +downstreamnt
atggatatatcaacaacgaatactagtactcaagtaaataacaataacggtcattatatt
ggtgcagaacttgttgatgtgaaacttgtcgaggtggcaagtaatgacgtaacggcctta
agtgcaaaagattttttagatgccaagtttccactcgctaatggttctcataaaaatgcc
tgtagctatgtgatctattatcagcaattattggtgttcatggcagatggcagccaaaca
ggattacgccagcctaagcagtttgttgcgctaaacggtcataaaagtgaacctacagcg
attctgttgaaggacaaggggggtcatgtggagttaactttcgataggagtaaggcaaat
actaatcgagacctagccaaccttcaggatatacagctagaagggcatgagtattggatc
agtttgattaacatcgaaaacactgtggttgcatcttctatgcaagatcaagtatttacc
gctaaagatggcagtgactacctactaaaaagttaa

DBGET integrated database retrieval system