KEGG   Streptococcus pneumoniae TIGR4 (virulent serotype 4): SP_1052Help
Entry
SP_1052           CDS       T00057                                 

Definition
(GenBank) putative phosphoesterase
Organism
spn  Streptococcus pneumoniae TIGR4 (virulent serotype 4)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAK75166
UniProt: Q97QZ0
Position
989317..990093
Genome map
AA seq 258 aa AA seqDB search
MRGFNNKIKSVYQELTNSKEKFGSFHKTLIHLHTPVSYDYKLFSNWTATKYRKITEDELY
DIFFENKKIKVDKTIFFSNFDKVVFSSSKEYISFLMLAEAIIKNGIEIVVVTDHNTTKGI
KKLQMAVSIIMKNYPIYDIHPHILHGVEISAADKLHIVCIYDYEQESWVNQWLSENIISE
KDGSYQHSLTIMKDFNNQKIVNYIAHFNSYDILKKGSHLSGAYKRKIFSKENTRFWSLIL
TRKNLRNNLIFSIKKLVY
NT seq 777 nt NT seq  +upstreamnt  +downstreamnt
atgagagggtttaataacaagataaagtctgtttatcaagaactaacaaattccaaagag
aaattcggtagctttcacaagactttaattcatttgcatacacctgtttcttatgattac
aagctattttctaattggactgcaacgaaatatagaaaaattactgaagatgaactatat
gatatattttttgaaaataagaaaataaaagttgataagacaattttttttagtaatttt
gataaggttgttttttctagttcaaaagaatatattagttttcttatgttagcagaggca
atcataaaaaatggaatagaaatagttgtagtaactgatcataatactaccaaaggtatt
aaaaagttacaaatggcagtctcaatcataatgaaaaattatccgatttatgatatacat
cctcatattttacatggagtagaaattagtgcagcagataaattgcatattgtatgtata
tatgattatgaacaagaatcatgggttaatcaatggttaagtgaaaatattataagtgag
aaagatggaagttatcaacattcactgactataatgaaggatttcaataatcaaaaaata
gttaactatattgctcatttcaatagttatgacattttgaaaaaaggttctcacttatca
ggtgcatataaacgaaaaattttttctaaagaaaatacacgattttggagtttaatatta
actcgaaagaatcttcgcaacaacttgatattctctataaagaagttggtgtattaa

DBGET integrated database retrieval system