KEGG   Streptococcus pneumoniae SPN034183: SPN034183_15750Help
Entry
SPN034183_15750   gene      T02629                                 

Definition
(GenBank) pseudogene
Organism
spnu  Streptococcus pneumoniae SPN034183
SSDB OrthologParalogGene clusterGFIT
Position
complement(1598715..1598777)
Genome map
NT seq 63 nt NT seq  +upstreamnt  +downstreamnt
ttgaactgtacctcaaaagttagacagaaaaaatctaatttttggggtgtttttgttaag
aaa

DBGET integrated database retrieval system