KEGG   Schizosaccharomyces pombe (fission yeast): SPCC1393.05
Entry
SPCC1393.05       CDS       T00076                                 

Symbol
ers1
Name
(RefSeq) RNA-silencing factor Ers1
Organism
spo  Schizosaccharomyces pombe (fission yeast)
SSDB
Other DBs
NCBI-GeneID: 2538690
NCBI-ProteinID: NP_587963
PomBase: SPCC1393.05
UniProt: O94717
Position
III:join(801197..801227,801264..801339,801379..801427,801467..801516,801572..801986,802032..803311,803362..803409,803447..803557,803600..803881,803932..804018,804060..804501)
AA seq 956 aa
MGKVSANNQSGFFKFYIDTALLLNAEFISSFTNCINSEYNGKVKISYSSSSQQFKVIVYE
EHKREAFSLFEEIVQKLKRESTVYKKPRLDIHPFGQLHYDFTTLLNFQRYLDLGYGIEDV
KIKENEDIVKSKVGKKPTSSDFYIPCLIKPKIITPFEWEGNFKQVIYSPTVYNGSFKRLF
YLPDNNDLLKEFAHATNTKYKASLKDNKIVVLANNDQDINAMLEKMKHIENLVSQKVYEY
PEETLVYAGKIAPCQLKFLKLKFENEILYTAMHTTSIFKSVFNILGSFYTMRLLRNKHDG
DSYELVPVFAKNPSKTPPCNDNFKIFSDDIKLIGCKIFAGVSLNFSSPKPAHRFYELNKT
SSNLSIPVLQKPSNFHSSSTELSDNSIHQGRRAVDPVVNQNNPSNFEEMIMNKLNKLPTI
DKQILGTSSLTHFQDKTTAIEHSINKSNSKQPPRFKFQLPPRPTSNTLPLEPEEELVTRY
SVSSDGNTVDEAITKQSQTFQLVNSNEFNEVNANDVHKSLRQNCAKLDFDDSKSKNLLSV
ECLELDKGSDCSTPKSGSLTPSIDMKFLRLQDEKMDDLGDNYYTILMSSNPVSSYGVGSL
YLFQPKIVCSEKYINHEEIDNMNLKSLHRWLSRSLHVLQSFSGEIELNLEFGVILYPNIS
SDVSACSHGFMNIYKDLNLPRSYFADCITKSVSNIDSLLNTPVKILFGRTEYTYPLIEHE
VLDSKNYFVFKGSLLFTDDKRNKTEDSTVFFSMICSSKLDQFAFYKDSKQSSTCTINFPL
ALWDSRLRIETKVPLNDAILTEFSKSIRFRNVNKDLLLVFGNMEDRVIIHSVTRINENSV
PFNKNLLPHSLEFILKCSKVKSYDISPSSINSKEAFVCLDRSKESKPIESCFSLSIQSVY
MQSQFKYNNSIRAGETAPWKLANKQFIGGAITENVSDLYTAAIIMVNQLGGIHPTI
NT seq 2871 nt   +upstreamnt  +downstreamnt
atgggtaaagtatctgcaaacaatcaatctggattttttaaattttatatcgatacagcg
ttgcttttaaatgctgaatttatatcctccttcacaaattgtataaattctgaatataat
ggaaaagtaaaaatttcttactcttcttcatctcagcaattcaaagtcatagtgtacgag
gaacacaaaagagaagcgtttagtctttttgaggaaatagttcaaaagttgaagcgcgaa
tcaactgtttacaagaaaccacgcctagatattcatccattcgggcaattgcattatgat
tttactactttattgaattttcaaaggtacttagacttaggatacggtattgaagatgtg
aaaataaaagaaaatgaggacattgttaagtctaaagtgggcaagaaaccgacatcctcc
gatttttatattccttgcttgataaaacctaaaatcattactccttttgaatgggaagga
aattttaaacaggtcatttattcgcctactgtttacaacgggagtttcaagcgattattt
taccttcccgacaataatgatttgctcaaggagtttgcgcatgctaccaacacaaaatac
aaggcttctttaaaagataataaaatagttgtattagccaataacgatcaggacattaat
gctatgttggagaaaatgaagcatatagagaatttagtgtcccagaaagtctatgaatat
cctgaagaaactcttgtttatgcaggaaagattgcaccctgccaactgaaatttctaaaa
ttaaaatttgaaaacgagattttatacacagctatgcatacgacatctattttcaaaagc
gttttcaatatccttggatctttttatactatgagattattgagaaataaacatgatggt
gattcttatgagttggtaccagtttttgctaaaaatccttccaaaacccctccctgtaat
gataattttaaaatattttctgatgatataaagctgataggatgtaaaatatttgcaggt
gtttctttaaacttctcttctccgaaaccagcgcacagattttacgagttaaataaaact
tcatccaatttgtcgatcccagtcttacaaaagccgtcaaattttcattcttcgtcaacc
gaattatctgataattcaattcatcaaggaaggagagcagttgatcctgttgttaaccag
aataatccgtcaaattttgaagaaatgattatgaacaagttgaataaattacccacgatt
gataagcaaattttaggaacttcatctttgacccatttccaagataaaacaactgcaatt
gagcattcaattaataagtctaatagcaagcagcctcctcggttcaaatttcagcttcct
cctcgacctacgagcaatactttaccattggaacctgaagaagagctggttactagatat
tctgtttcttcggatggtaatactgttgacgaagcaataactaaacagtctcagactttt
caattggtcaattcaaatgaatttaatgaagttaacgctaatgatgttcataaatctttg
cgacaaaattgcgcaaaattggatttcgacgattcaaagtctaaaaacctattaagtgta
gaatgtttagagcttgacaaaggatcagattgttccactccaaaatctggcagcttaact
ccttcaattgacatgaagtttttacgtttacaagatgagaaaatggacgaccttggtgac
aactattatacaattctaatgtcttccaatccggtatcaagctacggtgtgggaagctta
tacttatttcaaccaaaaatagtatgctctgaaaaatacattaatcacgaagagattgac
aacatgaatttgaaatcattgcacagatggttatctagaagcttgcatgtacttcaatcc
ttttcaggtgaaattgaattgaatttagagtttggcgtcatactatatccaaatatctca
tcagatgtgtcggcttgttcacatggttttatgaatatatataaggatttgaatcttccc
cgatcatattttgcagactgcattaccaaatcagtttcgaatatcgattcattattgaat
actcctgtgaaaattttgtttggacgtactgagtatacttatcctttaatagagcatgaa
gtattagattcaaagaattactttgttttcaagggaagtttattatttacagatgataag
agaaacaagacagaggattccactgtatttttttcgatgatttgttcttcaaagttagat
cagtttgcgttttataaagattctaagcaatcttctacttgcactatcaattttccttta
gccttatgggattcccgtctacgtatcgaaacgaaagtccctttaaatgatgcgatactt
acagagttctccaaaagtattagatttagaaacgtaaataaggatttactgttagtcttt
ggaaatatggaagacagagtaataattcattcggtcacaagaattaatgaaaactctgta
ccttttaacaaaaatttactccctcactctctagaatttatattaaaatgttcaaaagtt
aagagctatgacattagcccgtcatctattaattccaaagaagccttcgtttgtctcgac
agatccaaggaaagcaaacctatagaatcctgtttcagtctaagtatacaaagtgtgtac
atgcagtctcagttcaaatataataacagtatacgcgcaggagaaacggctccgtggaaa
cttgcaaataaacaattcattggtggggctattactgagaatgtttcagacttgtatact
gcagcaattattatggtgaatcaattaggggggatacaccctactatttaa

DBGET integrated database retrieval system