KEGG   Serratia plymuthica 4Rx13: SOD_c00580Help
Entry
SOD_c00580        CDS       T02710                                 

Gene name
xylA1
Definition
(GenBank) xylose isomerase XylA
  KO
K01805  xylose isomerase [EC:5.3.1.5]
Organism
srl  Serratia plymuthica 4Rx13
Pathway
srl00040  Pentose and glucuronate interconversions
srl00051  Fructose and mannose metabolism
srl01100  Metabolic pathways
Brite
KEGG Orthology (KO) [BR:srl00001]
 09100 Metabolism
  09101 Carbohydrate metabolism
   00040 Pentose and glucuronate interconversions
    SOD_c00580 (xylA1)
   00051 Fructose and mannose metabolism
    SOD_c00580 (xylA1)
Enzymes [BR:srl01000]
 5. Isomerases
  5.3  Intramolecular oxidoreductases
   5.3.1  Interconverting aldoses and ketoses, and related compounds
    5.3.1.5  xylose isomerase
     SOD_c00580 (xylA1)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AGO53094
UniProt: S0AAS2
Position
complement(65210..66601)
Genome map
AA seq 463 aa AA seqDB search
MSHRVLTPKINASRKPGIATQESKMQSYFDQLEQVRYEGPDSNNPLAFRHYNPDELVLGK
RMADHLRFAACYWHTFCWNGADMFGVGAFDRPWQQPGDALALAKRKADVAFEFFHKLNVP
YYCFHDVDVSPEGASLKEYLNNFAVMTDVLAEKQQSSGVKLLWGTANCFTHPRYGAGAAT
NPDPEVFSWAATQVFTAMNATHRLGGENYVLWGGREGYETLLNTDLRQEREQIGRFMQMV
VEHKHKTGFQGTLLIEPKPQEPTKHQYDYDVATVYGFLKQFGLEKEIKVNIEANHATLAG
HSFHHEIATAIALGIFGSVDANRGDPQLGWDTDQFPNSVEENALVMFEILKAGGFTTGGL
NFDAKVRRQSTDKYDLFYGHIGAMDTMALALKVAAKMTADGRLPQQVARRYAGWNGELGQ
QILQGKLSLEALAQYAEQHALAPQHASGRQEQLENLMNRYLFG
NT seq 1392 nt NT seq  +upstreamnt  +downstreamnt
ttgagccaccgggttctaactccgaagataaatgcatcccgtaaaccgggcatcgctacc
caggagtcgaaaatgcaatcctattttgatcagcttgagcaagttcgctacgaaggcccc
gacagcaataacccgctggctttccgccactataatcccgatgagttggtactcggcaaa
cgtatggccgatcacctgcgcttcgccgcctgttactggcacaccttctgctggaacggc
gcggacatgttcggcgtcggggccttcgatcgcccctggcagcagccgggcgatgcgctg
gcgctggcaaaacgcaaggccgacgtggcgttcgaattcttccacaagctgaacgtgcct
tactattgcttccatgacgtcgacgtgtcgccggaaggcgcttcgctgaaagaatatctg
aataactttgcggtgatgaccgacgtgctggcggaaaagcagcaaagcagcggcgtgaag
ctgttgtggggcaccgccaactgctttacccatccgcgctacggcgcaggcgcggccacc
aatccggatccggaagtgttcagttgggcggccacgcaggtattcaccgccatgaacgcc
actcatcgactgggcggcgagaactacgtgctgtggggcggacgcgaaggttacgaaacc
ctgctgaataccgatctgcgccaggagcgcgagcagattggccgctttatgcaaatggtg
gtggagcacaaacacaaaaccggtttccagggcacgctgctgatcgaacccaaaccgcag
gaacccaccaagcaccagtacgactacgatgtcgccacggtgtacggcttcctgaagcag
ttcgggctagagaaggagatcaaggtcaatatcgaggccaaccacgccaccctggccggg
cactccttccaccatgaaatcgccaccgccatcgcactcggcatcttcggctcggtcgac
gccaaccgtggcgatccgcagctgggctgggataccgaccagttccccaacagcgtggag
gagaacgccctggtgatgttcgaaatcctcaaggccggcggtttcaccaccggtggcctg
aacttcgacgccaaggtccgccgtcaaagcaccgacaaatacgatctgttctacggccat
atcggtgcgatggataccatggcgctggcgctgaaagtggcggccaaaatgaccgccgac
ggccggcttcctcagcaggtcgcccgacgttacgccggctggaacggtgagctgggccag
caaattttgcagggcaaactgtcgctggaagccctggcgcagtacgctgaacaacatgca
ctggcgccgcagcacgccagcggccgtcaggaacagcttgagaacctgatgaaccgctac
ctgttcggttaa

DBGET integrated database retrieval system