KEGG   Serratia plymuthica 4Rx13: SOD_c46290Help
Entry
SOD_c46290        CDS       T02710                                 

Gene name
grxC
Definition
(GenBank) glutaredoxin-3
  KO
K03676  glutaredoxin 3
Organism
srl  Serratia plymuthica 4Rx13
Brite
KEGG Orthology (KO) [BR:srl00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03110 Chaperones and folding catalysts [BR:srl03110]
    SOD_c46290 (grxC)
Chaperones and folding catalysts [BR:srl03110]
 Protein folding catalysts
  Protein disulfide isomerase
   SOD_c46290 (grxC)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Glutaredoxin GST_N_3 GST_N_2 SH3BGR DUF836 Thioredoxin_3
Motif
Other DBs
NCBI-ProteinID: AGO57565
UniProt: S0ANW1
Position
complement(5203689..5203937)
Genome map
AA seq 82 aa AA seqDB search
MANIDIYTKATCPFCHRAKALLNSKGAAFNEIAIDGDNEKREAMIARSGRTTVPQIFIDD
RHIGGCDDLYELDARGGLDPLL
NT seq 249 nt NT seq  +upstreamnt  +downstreamnt
atggctaacattgatatctacaccaaagcgacctgtccgttctgccatcgcgccaaagcg
ctgctgaacagtaagggcgcggcgtttaacgaaatcgccattgatggcgataatgaaaaa
cgcgaagcgatgattgcgcgcagtgggcgcaccaccgtgcctcagattttcatcgacgac
cggcatatcggcggctgcgatgatttatatgaactcgatgctcgtggtggtctggatccg
ttgctataa

DBGET integrated database retrieval system