KEGG   Sus scrofa (pig): 397123Help
Entry
397123            CDS       T01009                                 

Gene name
MT3
Definition
(RefSeq) metallothionein-3
  KO
K14740  metallothionein 3
Organism
ssc  Sus scrofa (pig)
Brite
KEGG Orthology (KO) [BR:ssc00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03029 Mitochondrial biogenesis [BR:ssc03029]
    397123 (MT3)
Mitochondrial biogenesis [BR:ssc03029]
 Mitochondrial quality control factors
  Regulator of mitochondrial biogenesis
   Nuclear respiratory factors
    397123 (MT3)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif
Pfam: Metallothio
Motif
Other DBs
NCBI-GeneID: 397123
NCBI-ProteinID: NP_999221
UniProt: P55944
Position
6
AA seq 68 aa AA seqDB search
MDPETCPCPTGGSCTCAGSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEGAEAE
EEKCSCCQ
NT seq 207 nt NT seq  +upstreamnt  +downstreamnt
atggaccctgagacctgcccctgccctactggtggctcctgcacctgcgctggctcctgc
aagtgcgagggatgcaaatgcacctcctgcaagaagagctgctgctcctgctgccctgcc
gagtgtgagaaatgcgccaaggattgcgtgtgtaaaggtggagagggggccgaagctgag
gaagagaagtgcagctgctgccagtga

DBGET integrated database retrieval system