KEGG   Salmonella enterica subsp. enterica serovar Typhimurium LT2: STM2394Help
Entry
STM2394           tRNA      T00065                                 

Gene name
argW
Definition
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
stm  Salmonella enterica subsp. enterica serovar Typhimurium LT2
Pathway
stm00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:stm00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    STM2394 (argW)
Non-coding RNAs [BR:stm03100]
 Transfer RNA
  tRNA
   STM2394 (argW)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1253916
Position
2505821..2505892
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
ttgtccccttagttaaatggatataacgagcccctcctaagggctagttgcaggttcgat
tcctgcagggga

DBGET integrated database retrieval system