KEGG   Salmonella enterica subsp. enterica serovar Typhimurium LT2: STM2411Help
Entry
STM2411           tRNA      T00065                                 

Gene name
alaX
Definition
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
stm  Salmonella enterica subsp. enterica serovar Typhimurium LT2
Pathway
stm00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:stm00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    STM2411 (alaX)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:stm03100]
    STM2411 (alaX)
Non-coding RNAs [BR:stm03100]
 Transfer RNA
  tRNA
   STM2411 (alaX)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1253933
Position
complement(2528938..2529010)
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
ggctatagctcagctgggagagcgcttgcatggcatgcaagaggtcagcggttcgatccc
gcttagctccacc

DBGET integrated database retrieval system